|
|
| (13 intermediate revisions by 4 users not shown) |
| Line 1: |
Line 1: |
| − | {| class="tutorialheader"
| + | #REDIRECT [[Tripal Tutorial v1.1]] |
| − | | align="right" | {{#icon: TripalLogo.jpg|Tripal|200|Tripal}}<br />{{#icon: 2009SummerSchoolAmericas170.png|2009 GMOD Summer School - Americas|120|2009 GMOD Summer School - Americas}}
| + | |
| − | | {{TutorialTitleLine|[[Tripal]]}}<br />
| + | |
| − | [[2009 GMOD Summer School - Americas]]<br />
| + | |
| − | 19 July 2009<br />
| + | |
| − | [[User:Sficklin|Stephen Ficklin]]
| + | |
| − | |}
| + | |
| − | __NOTITLE__
| + | |
| − | | + | |
| − | This [[:Category:Tutorials|tutorial]] walks you through installing and configuring [[Tripal]], a web front end to [[Chado]] databases. This tutorial was originally taught by [[User:Sficklin|Stephen Ficklin]] at the [[2009 GMOD Summer School - Americas]].
| + | |
| − | | + | |
| − | This tutorial references (and complements) the [[Media:TripalUsersGuideJune2009.pdf|Tripal User's Guide, June 2009 edition]].
| + | |
| − | | + | |
| − | | + | |
| − | __TOC__
| + | |
| − | | + | |
| − | | + | |
| − | == VMware ==
| + | |
| − | {|
| + | |
| − | | valign="top" |This tutorial was taught using a [[VMware]] system image as a starting point. If you want to start with that same system, download and install the ''Starting'' image.
| + | |
| − | | + | |
| − | '''See [[VMware]] for what software you need to use a VMware system image, and for directions on how to get the image setup and running on your machine.'''
| + | |
| − | |
| + | |
| − | {| style="margin-left: 1em; margin-top: 0; " class="wikitable"
| + | |
| − | ! Download
| + | |
| − | |-
| + | |
| − | | align="center" | [ftp://ftp.gmod.org/pub/gmod/Courses/2009/SummerSchoolAmericas/GmodSumSch2009Amer4.zip Starting Image]<br>
| + | |
| − | [ftp://ftp.gmod.org/pub/gmod/Courses/2009/SummerSchoolAmericas/GmodSumSch2009Amer5.tar.gz Ending Image]<br />
| + | |
| − | ----
| + | |
| − | Username: gmod<br />Password: gmod
| + | |
| − | |}
| + | |
| − | |}
| + | |
| − | | + | |
| − | == Caveats ==
| + | |
| − | | + | |
| − | {{TutorialCaveats}}
| + | |
| − | | + | |
| − | | + | |
| − | ==Background ==
| + | |
| − | | + | |
| − | # [[Tripal]] is open source and currently in 'Beta'.
| + | |
| − | # More modules and documentation are coming
| + | |
| − | # Tripal is designed to be customizable.
| + | |
| − | # Success will be in large part due to community response.
| + | |
| − | # Data loaded into [[Chado]] for this course was taken from the [http://www.yeastgenome.org/ YeastDB website].
| + | |
| − | | + | |
| − | ==Pre-Course Setup ==
| + | |
| − | By way of information the following steps were performed beforehand to the [[#VMware|VMware]] image for the [[2009 GMOD Summer School - Americas|class]]. These steps will not be needed during the class but are here for reference.
| + | |
| − | | + | |
| − | ===Prepare Postgres===
| + | |
| − | We need to create two [[PostgreSQL]] databases, one for the [[Chado]] tables and the other for the [http://drupal.org Drupal] tables.
| + | |
| − | | + | |
| − | sudo su - postgres
| + | |
| − | | + | |
| − | Create the user that will manage the yeast database:
| + | |
| − | | + | |
| − | postgres@gmod:~$ createuser -P yeast_admin
| + | |
| − | Enter password for new role: gmod
| + | |
| − | Enter it again: gmod
| + | |
| − | Shall the new role be a superuser? (y/n) n
| + | |
| − | Shall the new role be allowed to create databases? (y/n) y
| + | |
| − | Shall the new role be allowed to create more new roles? (y/n) n
| + | |
| − | | + | |
| − | Create the Chado and Drupal databases:
| + | |
| − | | + | |
| − | postgres@gmod:~$ createdb chado_yeast -O yeast_admin
| + | |
| − | postgres@gmod:~$ createdb drupal_yeast -O yeast_admin
| + | |
| − | | + | |
| − | ===Install Prereqs===
| + | |
| − | | + | |
| − | XSLT
| + | |
| − | | + | |
| − | apt-get install xsltproc
| + | |
| − | | + | |
| − | Install the Postgres development tools:
| + | |
| − | | + | |
| − | sudo apt-get install libpq-dev
| + | |
| − | | + | |
| − | Install the needed Perl modules
| + | |
| − | | + | |
| − | sudo perl -MCPAN -e shell
| + | |
| − | | + | |
| − | install GO::Parser
| + | |
| − | install Template
| + | |
| − | install XML::Simple
| + | |
| − | install Log::Log4perl
| + | |
| − | install XML::Parser::PerlSAX
| + | |
| − | install DBI
| + | |
| − | install DBD::Pg
| + | |
| − | install DBIx::DBSchema
| + | |
| − | install DBIx::DBStag
| + | |
| − | install Parse::RecDescent
| + | |
| − | | + | |
| − | Needed for [http://www.genome.clemson.edu/ CUGI] scripts
| + | |
| − | | + | |
| − | install Spreadsheet::WriteExcel
| + | |
| − | | + | |
| − | | + | |
| − | [[BioPerl]]
| + | |
| − | | + | |
| − | cd /home/gmod/tripal/packages
| + | |
| − | wget http://bioperl.org/DIST/BioPerl-1.6.0.tar.gz
| + | |
| − | tar -zxvf BioPerl-1.6.0.tar.gz
| + | |
| − | cd BioPerl-1.6.0/
| + | |
| − | perl Makefile.PL
| + | |
| − | make
| + | |
| − | sudo make install
| + | |
| − | | + | |
| − | Install the go-perl modules:
| + | |
| − | | + | |
| − | cd /home/gmod/tripal/packages
| + | |
| − | wget http://search.cpan.org/CPAN/authors/id/C/CM/CMUNGALL/go-perl-0.09.tar.gz
| + | |
| − | tar -zxvf go-perl-0.09.tar.gz
| + | |
| − | cd go-perl-0.09
| + | |
| − | perl Makefile.PL
| + | |
| − | make
| + | |
| − | sudo make install
| + | |
| − | | + | |
| − | ===Chado Installation===
| + | |
| − | Download and extract the gmod package:
| + | |
| − | <pre>
| + | |
| − | cd /home/gmod/tripal/packages
| + | |
| − | wget http://internap.dl.sourceforge.net/sourceforge/gmod/gmod-1.0.tar.gz
| + | |
| − | tar -zxvf gmod-1.0.tar.gz
| + | |
| − | cd gmod-1.0
| + | |
| − | | + | |
| − | export GO_ROOT=/home/gmod/tripal/lib
| + | |
| − | export GMOD_ROOT=/home/gmod/tripal/lib/gmod-1.0
| + | |
| − | export CHADO_DB_NAME=chado_yeast
| + | |
| − | export CHADO_DB_USERNAME=yeast_admin
| + | |
| − | export CHADO_DB_PASSWORD=gmod
| + | |
| − | export CHADO_DB_HOST=localhost
| + | |
| − | export CHADO_DB_PORT=5432
| + | |
| − | | + | |
| − | | + | |
| − | perl Makefile.PL PREFIX=/home/gmod/tripal/gmod-1.0
| + | |
| − | | + | |
| − | Use the simple install (uses default database schema, which contains
| + | |
| − | all of the modules and extensions to the schema and all of the non-trigger functions.
| + | |
| − | This is probably what you want) [Y]
| + | |
| − | What database server will you be using? [PostgreSQL]
| + | |
| − | What is the Chado database name? [chado_yeast]
| + | |
| − | What is the database username? [yeast_admin]
| + | |
| − | What is the password for 'yeast_admin'? [gmod]
| + | |
| − | What is the database host? [localhost]
| + | |
| − | What is your database port? [5432]
| + | |
| − | Where shall downloaded ontologies go? [./tmp]
| + | |
| − | What is the default organism (common name, or "none")? []
| + | |
| − | Do you want to make this the default chado instance? [y]
| + | |
| − | | + | |
| − | Building with the following database options:
| + | |
| − | GMOD_ROOT=/home/gmod/tripal/gmod-1.0
| + | |
| − | DBDRIVER=PostgreSQL
| + | |
| − | DBNAME=chado_yeast
| + | |
| − | DBUSER=yeast_admin
| + | |
| − | DBPASS=gmod
| + | |
| − | DBHOST=localhost
| + | |
| − | DBPORT=5432
| + | |
| − | LOCAL_TMP=./tmp
| + | |
| − | DBORGANISM=
| + | |
| − | DEFAULT=y
| + | |
| − | | + | |
| − | Extracting /home/gmod/tripal/packages/gmod-1.0/bin/../lib/Chado/AutoDBI.pm (with variable substitutions)
| + | |
| − | Checking whether your kit is complete...
| + | |
| − | Looks good
| + | |
| − | | + | |
| − | Checking prerequisites...
| + | |
| − | Looks good
| + | |
| − | | + | |
| − | initializing load scripts...
| + | |
| − | Deleting Build
| + | |
| − | Removed previous script 'Build'
| + | |
| − | | + | |
| − | Creating new 'Build' script for 'Chado' version '0.01'
| + | |
| − | | + | |
| − | <snip>
| + | |
| − | | + | |
| − | -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-
| + | |
| − | Makefile written. Now you should do the following, in order:
| + | |
| − | 1. make (creates necessary build files)
| + | |
| − | 2. sudo make install (creates $GMOD_ROOT and subdirectories)
| + | |
| − | -*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*WARNING-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*
| + | |
| − | STEP 3 WILL DELETE ANY DATA IN A DATABASE WITH THE
| + | |
| − | DATABASE NAME YOU PROVIDED!
| + | |
| − | -*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*WARNING-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*
| + | |
| − | 3. make load_schema (loads SQL schema into database)
| + | |
| − | 4. make prepdb (loads basic data)
| + | |
| − | 5. make ontologies (loads data for various ontologies)
| + | |
| − | | + | |
| − | Optional Targets:
| + | |
| − | make rm_locks (removes ontology lock files, allowing installation
| + | |
| − | of ontologies on successive builds of the database
| + | |
| − | without removing the ontology files altogether)
| + | |
| − | make clean (remove build related files and ontology tmp dir)
| + | |
| − | make instructions (at any moment display these instructions)
| + | |
| − | | + | |
| − | -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-
| + | |
| − | | + | |
| − | | + | |
| − | make
| + | |
| − | sudo make install
| + | |
| − | make load_schema
| + | |
| − | make prepdb
| + | |
| − | make ontologies
| + | |
| − | </pre>
| + | |
| − | | + | |
| − | === Web Prep ===
| + | |
| − | ;Install php
| + | |
| − | | + | |
| − | apt-get install php5
| + | |
| − | apt-get install php5-pgsql
| + | |
| − | apt-get install php5-cli
| + | |
| − | apt-get install php5-gd
| + | |
| − | | + | |
| − | Change some php settings (as root):
| + | |
| − | <div class="emphasisbox">Changes to php.ini were not present in the VMware image used in the [[2009 GMOD Summer School - Americas|course]]. Please update both <tt>php.ini</tt> files.
| + | |
| − | </div>
| + | |
| − | cd /etc/php5/apache2
| + | |
| − | vi php.ini
| + | |
| − | {{TextEditorLink|vi}}
| + | |
| − | | + | |
| − | Set the <tt>memory_limit</tt> to something larger than 16M (should not exceed physical memory, be conservative but not too much so):
| + | |
| − | | + | |
| − | memory_limit = 2048M;
| + | |
| − | | + | |
| − | Now, restart the webserver:
| + | |
| − | | + | |
| − | /etc/init.d/apache2 restart
| + | |
| − | | + | |
| − | Do the same for the command-line <tt>php.ini</tt>:
| + | |
| − | | + | |
| − | cd /etc/php5/cli/
| + | |
| − | vi php.ini
| + | |
| − | {{TextEditorLink|vi}}
| + | |
| − | | + | |
| − | Set the memory limit:
| + | |
| − | | + | |
| − | memory_limit = 2048M;
| + | |
| − | | + | |
| − | ;Install phpPgAdmin
| + | |
| − | | + | |
| − | cd /home/gmod/tripal/packages
| + | |
| − | wget http://downloads.sourceforge.net/phppgadmin/phpPgAdmin-4.2.2.tar.gz?download
| + | |
| − | | + | |
| − | As root:
| + | |
| − | cd /var/www
| + | |
| − | tar -zxvf /home/gmod/tripal/packages/phpPgAdmin-4.2.2.tar.gz
| + | |
| − | ln -s phpPgAdmin-4.2.2/ phppgadmin
| + | |
| − | | + | |
| − | === Load Yeast Data ===
| + | |
| − | | + | |
| − | Download the [[GFF]] file available from the yeast genome website:
| + | |
| − | | + | |
| − | cd /home/gmod/tripal/data
| + | |
| − | wget http://downloads.yeastgenome.org/chromosomal_feature/saccharomyces_cerevisiae.gff
| + | |
| − | | + | |
| − | Download the coding segments from the Yeast Genome website:
| + | |
| − | | + | |
| − | wget http://downloads.yeastgenome.org/sequence/genomic_sequence/orf_dna/orf_coding.fasta.gz
| + | |
| − | | + | |
| − | Adjust the <tt>gmod_bulk_load_gff3.pl</tt> so it can find the gmod libraries (we didn't install in a default location):
| + | |
| − | | + | |
| − | use lib "/home/gmod/tripal/gmod-1.0/share/perl/5.8.8";
| + | |
| − | | + | |
| − | | + | |
| − | Load the GFF into our [[Chado]] database
| + | |
| − | | + | |
| − | export GMOD_ROOT=/home/gmod/tripal/gmod-1.0
| + | |
| − | ../gmod-1.0/bin/gmod_bulk_load_gff3.pl \
| + | |
| − | --dbname chado_yeast \
| + | |
| − | --dbuser yeast_admin \
| + | |
| − | --dbhost localhost \
| + | |
| − | --dbpass demo \
| + | |
| − | --organism yeast \
| + | |
| − | --gff saccharomyces_cerevisiae.gff \
| + | |
| − | --recreate_cache \
| + | |
| − | --no_target_syn
| + | |
| − | | + | |
| − | | + | |
| − | === Prepare Apache ===
| + | |
| − | | + | |
| − | Enable the rewrite module for Apache. This is useful so that we can use Clean URLs with Drupal. Clean URLs are not required but make the page URLs easier to use:
| + | |
| − | | + | |
| − | cd /etc/apache2/mods-enabled
| + | |
| − | sudo ln -s ../mods-available/rewrite.load
| + | |
| − | | + | |
| − | | + | |
| − | Edit the configuration file and change the <tt>AllowOverride</tt> from 'None' to 'All'
| + | |
| − | | + | |
| − | cd /etc/apache2/sites-enabled
| + | |
| − | sudo vi 000-default
| + | |
| − | {{TextEditorLink|vi}}
| + | |
| − | <Directory /var/www/>
| + | |
| − | Options Indexes FollowSymLinks MultiViews
| + | |
| − | AllowOverride All
| + | |
| − | Order allow,deny
| + | |
| − | allow from all
| + | |
| − | </Directory>
| + | |
| − | | + | |
| − | Restart the web server
| + | |
| − | | + | |
| − | sudo /etc/init.d/apache2 restart
| + | |
| − | | + | |
| − | == Install Drupal ==
| + | |
| − | | + | |
| − | cd /var/www
| + | |
| − | mv index.html index.old.html
| + | |
| − | sudo tar -zxvf /home/gmod/tripal/packages/drupal-6.13.tar.gz
| + | |
| − | | + | |
| − | Now that we've unpacked Drupal, we'll move some things around.
| + | |
| − | cd drupal-6.13
| + | |
| − | sudo mv .htaccess * ../
| + | |
| − | | + | |
| − | Set permissions so we can easily work with
| + | |
| − | | + | |
| − | cd /var
| + | |
| − | sudo chown -R gmod:gmod www
| + | |
| − | | + | |
| − | This will undo the permission changes we did yesterday with [[GBrowse]]. Redo them.
| + | |
| − | sudo chmod 777 -r /var/www/gbrowse/{tmp,databases}
| + | |
| − | | + | |
| − | Be more careful in real life.
| + | |
| − | | + | |
| − | Configure Drupal
| + | |
| − | | + | |
| − | cd /var/www/sites/default
| + | |
| − | cp default.settings.php settings.php
| + | |
| − | vi settings.php
| + | |
| − | {{TextEditorLink|vi}}
| + | |
| − | | + | |
| − | Change the <tt>$db_url</tt> argument to be:
| + | |
| − | | + | |
| − | $db_url = array (
| + | |
| − | 'default' => 'pgsql://yeast_admin:demo@localhost/drupal_yeast',
| + | |
| − | 'chado' => 'pgsql://yeast_admin:demo@localhost/chado_yeast'
| + | |
| − | );
| + | |
| − | | + | |
| − | Make the <tt>files</tt> directory writable by the webserver
| + | |
| − | | + | |
| − | mkdir files
| + | |
| − | sudo chgrp www-data files
| + | |
| − | chmod g+rw files
| + | |
| − | | + | |
| − | | + | |
| − | Point Browser to the webserver and follow the two easy pages for installing and then configuration the Drupal site.
| + | |
| − | | + | |
| − | http://localhost/install.php
| + | |
| − | | + | |
| − | The username and password are
| + | |
| − | * Username: yeast_admin
| + | |
| − | * Password: gmod
| + | |
| − | | + | |
| − | == Review the features of Drupal ==
| + | |
| − | ; User Accounts
| + | |
| − | * View History
| + | |
| − | * Edit the Account
| + | |
| − | | + | |
| − | ; Create Content
| + | |
| − | * Create a 'Home' page
| + | |
| − | * Create an 'About' page
| + | |
| − | | + | |
| − | ; Administration - Content Management
| + | |
| − | * Content Management → Content
| + | |
| − | * Content Management → Taxonomy
| + | |
| − | | + | |
| − | ; Administration - Site Building
| + | |
| − | * Site Building → Blocks
| + | |
| − | ** Add the "Who's Online" block to the left sidebar.
| + | |
| − | | + | |
| − | * Site Building → Menu
| + | |
| − | ** Add a 'Home' link
| + | |
| − | ** Add an 'About' link
| + | |
| − | | + | |
| − | * Site Building → Modules
| + | |
| − | ** Tripal requires the Path and Search modules. Enable those.
| + | |
| − | ** Return to the About link and add an alias.
| + | |
| − | ** Return to the Menu and update the about link.
| + | |
| − | ** Return to the Blocks administration and add a search box to header.
| + | |
| − | ** Navigate to Drupal.org and click on 'Modules'. Review the wealth of public modules.
| + | |
| − | | + | |
| − | * Site Building → Themes
| + | |
| − | ** Change the theme to Pushbutton.
| + | |
| − | ** Configure the theme and remove the search box.
| + | |
| − | | + | |
| − | ; Administration - User Management
| + | |
| − | * User Management → Roles
| + | |
| − | ** Create role 'webmaster'
| + | |
| − | ** Create role 'editor'
| + | |
| − | | + | |
| − | * User Management → Users
| + | |
| − | ** Add a user for yourself and set as webmaster.
| + | |
| − | | + | |
| − | * User Management → Permissions
| + | |
| − | ** Turn on everything for webmaster
| + | |
| − | ** Set 'Access Content' for editor (and whatever else)
| + | |
| − | | + | |
| − | * User Management → User Settings
| + | |
| − | | + | |
| − | ; Administration - Site Configuration
| + | |
| − | * Site Configuration → Performance
| + | |
| − | | + | |
| − | ; Administration - Reports
| + | |
| − | * Reports → Recent log entries
| + | |
| − | * Reports → Status reports
| + | |
| − | ** Run cron manually
| + | |
| − | | + | |
| − | == Setup Drupal Cron ==
| + | |
| − | | + | |
| − | Drupal requires an entry in the crontab to function:
| + | |
| − | | + | |
| − | crontab -e
| + | |
| − | {{TextEditorLink|nano}}
| + | |
| − | | + | |
| − | Add this line to the crontab
| + | |
| − | | + | |
| − | 0,30 * * * * /usr/bin/wget -O - -q <nowiki>http://localhost/cron.php</nowiki> > /dev/null
| + | |
| − | | + | |
| − | The cron will launch this job every 30 minutes.
| + | |
| − | | + | |
| − | == Tripal Resources ==
| + | |
| − | | + | |
| − | ;Availability
| + | |
| − | * Available soon for download on GMOD Sourceforge site
| + | |
| − | * Currently available on CUGI's website: http://www.genome.clemson.edu/software/tripal
| + | |
| − | | + | |
| − | | + | |
| − | ;Forum:
| + | |
| − | Users can post questions or request help from developers and the community using an online 'Tripal Help' forum:
| + | |
| − | http://www.genome.clemson.edu/forum
| + | |
| − | | + | |
| − | ;Mantis Bug Tracking
| + | |
| − | Navigate to http://www.genome.clemson.edu/mantis and sign up for an account. If you find any bugs or find odd behavior you can enter an issue into the tracking system.
| + | |
| − | | + | |
| − | ;Documentation and Helper Scripts
| + | |
| − | Documentation and helper scripts can be obtained on the CUGI website: http://www.genome.clemson.edu/software/tripal
| + | |
| − | | + | |
| − | | + | |
| − | == Tripal Overview ==
| + | |
| − | ;Module Overview
| + | |
| − | Review Table 1 in [[Media:TripalUsersGuideJune2009.pdf|User's Guide]]. (pg 12, June 2009 document).
| + | |
| − | | + | |
| − | Navigate to "Administer" → "Site Building" → "Modules": Dependencies are heirarchical.
| + | |
| − | | + | |
| − | | + | |
| − | ;Core Module
| + | |
| − | * Jobs -- long running items
| + | |
| − | * Taxonomy -- for advanced searching
| + | |
| − | * CVterms -- for customized data
| + | |
| − | * Materialized Views -- for speedy
| + | |
| − | * API for new modules -- for expandability
| + | |
| − | | + | |
| − | == Setup Tripal ==
| + | |
| − | === Install Tripal ===
| + | |
| − | | + | |
| − | Create the necessary directory structure
| + | |
| − | | + | |
| − | cd /var/www/sites/all
| + | |
| − | mkdir modules
| + | |
| − | mkdir themes
| + | |
| − | cd modules
| + | |
| − | | + | |
| − | Unpack the Tripal package into the <tt>modules</tt> directory:
| + | |
| − | | + | |
| − | tar -zxvf /home/gmod/tripal/packages/tripal-6.x-0.1b.tar.gz
| + | |
| − | | + | |
| − | Move the themes to the <tt>themes</tt> directory:
| + | |
| − | | + | |
| − | mv admire_gray-6.x-1.1.zip theme_tripal ../themes/
| + | |
| − | cd ../themes
| + | |
| − | unzip admire_gray-6.x-1.1.zip
| + | |
| − | | + | |
| − | === Enable the Tripal Modules ===
| + | |
| − | Navigate to the Modules Administration Page ("Administer" → "Site Building" → "Modules") and click the checkboxes for each of the tripal modules. Do not enable them all at once. Enable in groups:
| + | |
| − | | + | |
| − | Group 1 (dependencies, already enabled):
| + | |
| − | | + | |
| − | Path
| + | |
| − | Search
| + | |
| − | | + | |
| − | Group 2:
| + | |
| − | | + | |
| − | Tripal Core
| + | |
| − | | + | |
| − | Group 3:
| + | |
| − | | + | |
| − | Tripal Chado Organism
| + | |
| − | Tripal Chado Feature
| + | |
| − | Tripal Chado Library
| + | |
| − | Tripal Chado Analysis
| + | |
| − | | + | |
| − | === Setup Tripal Cron ===
| + | |
| − | | + | |
| − | Tripal also require an entry in the crontab to function:
| + | |
| − | | + | |
| − | crontab -e
| + | |
| − | {{TextEditorLink|nano}}
| + | |
| − | | + | |
| − | Add this line to the crontab
| + | |
| − | | + | |
| − | 0,15,30,45 * * * * (cd /var/www; php ./sites/all/modules/tripal_core/tripal_launch_jobs.php yeast_admin ) > /dev/null
| + | |
| − | | + | |
| − | The will run the Tripal cron every 15 miutes.
| + | |
| − | | + | |
| − | Test the cron job to make sure it works:
| + | |
| − | | + | |
| − | cd /var/www; php ./sites/all/modules/tripal_core/tripal_launch_jobs.php yeast_admin
| + | |
| − | | + | |
| − | Oops. It failed:
| + | |
| − | The program 'php' is currently not installed. You can install it by typing:
| + | |
| − | sudo apt-get install php5-cli
| + | |
| − | bash: php: command not found
| + | |
| − | | + | |
| − | So let's do that (and get php5-gd which we also need).
| + | |
| − | sudo apt-get install php5-cli
| + | |
| − | sudo apt-get install php5-gd
| + | |
| − | | + | |
| − | Now, try again.
| + | |
| − | cd /var/www; php ./sites/all/modules/tripal_core/tripal_launch_jobs.php yeast_admin
| + | |
| − | | + | |
| − | The Tripal job should execute and return the following:
| + | |
| − | | + | |
| − | Tripal Job Launcher
| + | |
| − | -------------------
| + | |
| − | | + | |
| − | | + | |
| − | ''Note:'' It is important the the final parameter be set to the name of the administrator account for Drupal. In our case 'yeast_admin'
| + | |
| − | | + | |
| − | == Organisms ==
| + | |
| − | === Sync the Organism ===
| + | |
| − | Navigate to the "Administer" → "Tripal Management" → "Organisms". Click the checkbox beside "Saccharomyces cerevisiae (yeast)"
| + | |
| − | | + | |
| − | '''Bug Fix''': before continuing we must create the images directory for the organism or the sync will fail. This is a bug in the code which will be fixed but here's a workaround:
| + | |
| − | | + | |
| − | cd /var/www/sites/default/files/tripal/tripal_organism
| + | |
| − | sudo mkdir images
| + | |
| − | sudo chown gmod:www-data images
| + | |
| − | sudo chmod g+w images
| + | |
| − | | + | |
| − | Rather than wait for at most 15 minutes for the cron to launch the job, we'll manually perform that now:
| + | |
| − | | + | |
| − | cd /var/www; php ./sites/all/modules/tripal_core/tripal_launch_jobs.php yeast_admin
| + | |
| − | | + | |
| − | Check the jobs page and notice the stats.
| + | |
| − | | + | |
| − | Now, the organism has a Drupal page! We can view it, but notice it has no useful content.. we need to add some. Click the 'Edit' tab at the top. For a description add the following (stolen from wikipedia):
| + | |
| − | | + | |
| − | :Saccharomyces cerevisiae is a species of budding yeast. It is perhaps the most useful yeast owing to its use since ancient times in baking and brewing. It is believed that it was originally isolated from the skins of grapes (one can see the yeast as a component of the thin white film on the skins of some dark-colored fruits such as plums; it exists among the waxes of the cuticle). It is one of the most intensively studied eukaryotic model organisms in molecular and cell biology, much like Escherichia coli as the model prokaryote. It is the microorganism behind the most common type of fermentation. Saccharomyces cerevisiae cells are round to ovoid, 5–10 micrometres in diameter. It reproduces by a division process known as budding.
| + | |
| − | | + | |
| − | But, our additional information did not show up! We need to install the Tripal theme.
| + | |
| − | | + | |
| − | === Setup the Tripal Theme ===
| + | |
| − | * The tripal theme is a sub theme so it is dependent on another theme to work. By default this is the admire-gray theme which accompanies Tripal. The admire-gray theme must be present but will not be enabled. Navigate to the "Administer" → "Site Building" → "Themes" page and select the 'Tripal Theme' radio button and checkbox, remove the check on the 'Garland' theme and click 'Save configuration'.
| + | |
| − | | + | |
| − | * Open a new tab in the browser and navigate to the "Administer" → "Site Building" → "Blocks" page. The theme has now changed to the admire-gray theme, but with Tripal "extensions". However, the menu item is floating in the middle of the page. The next step is to place the blocks in their proper place.
| + | |
| − | | + | |
| − | * Alter the blocks accordingly:
| + | |
| − | | + | |
| − | Navigation → Sidebar left
| + | |
| − | User login → Sidebar left
| + | |
| − | Powered by Drupal → <none>
| + | |
| − | Who's online → <none>
| + | |
| − | Libraries → Sidebar left
| + | |
| − | Organisms → Sidebar left
| + | |
| − | Search form → Header
| + | |
| − | | + | |
| − | Click 'Save blocks'. This should relocate the menu as well as the Tripal library and organism blocks to the left side of the page.
| + | |
| − | | + | |
| − | * Now return to the tab with the theme and click 'configure' for the 'Tripal Theme'. Adjust these parameters to your liking.
| + | |
| − | | + | |
| − | * Now, return to the organism page for 'Yeast' and we should see the information we added previously.
| + | |
| − | | + | |
| − | === Organism Materialized Views ===
| + | |
| − | The organism module is capable of showing the type and number of features for this organism. Currently that information does not appear on the Organism page. This behavior is controlled by a materialized view that is created when the module is installed but needs to be updated.
| + | |
| − | | + | |
| − | The SQL Statement
| + | |
| − | <sql>
| + | |
| − | SELECT O.organism_id, O.genus, O.species, O.common_name,
| + | |
| − | count(F.feature_id) as num_features,
| + | |
| − | CVT.name as feature_type
| + | |
| − | FROM Organism O
| + | |
| − | INNER JOIN Feature F ON O.Organism_id = F.organism_id
| + | |
| − | INNER JOIN Cvterm CVT ON F.type_id = CVT.cvterm_id
| + | |
| − | GROUP BY O.Organism_id, O.genus, O.species, O.common_name, CVT.name
| + | |
| − | </sql>
| + | |
| − | | + | |
| − | Navigate to the "Administer" → "Tripal Management" → "Materialized Views" page. Click 'update' for the view named 'organism_feature_count'. Rather than wait for the cron to launch the job, do it manually now:
| + | |
| − | | + | |
| − | cd /var/www; php ./sites/all/modules/tripal_core/tripal_launch_jobs.php yeast_admin
| + | |
| − | | + | |
| − | Return to the Yeast page and notice that a new box appeared with a listing of the types and number of features for the organism.
| + | |
| − | | + | |
| − | === Browse Features ===
| + | |
| − | Notice on the yeast page there is a section titled 'Browse Features' with no features listed. This display is managed by the Tripal Feature module. To show features in this box, navigate to the "Administer" → "Tripal Management" → "Features". In the box titled 'Feature Types' we will list all of the feature types that we want to show in the list. Chan the the text in the box to the following:
| + | |
| − | | + | |
| − | gene
| + | |
| − | | + | |
| − | Click 'Save configuration' and return to the Organism page. There is now a list of browseable features.
| + | |
| − | | + | |
| − | == Features ==
| + | |
| − | === Sync the Features ===
| + | |
| − | * Navigate to the "Administer" → "Tripal Management" → "Features". Before syncing any features we must first set the accession prefix and the feature types. Each feature on the site is assigned a unique accession number. Essentially this is the feature_id of the feature in the chado table. The prefix is added to the beginning of the feature_id to form the unique accession. The default is 'ID'. Let's change this to YDB (which represents yeast database)
| + | |
| − | | + | |
| − | * Next, the site will only create drupal content for those features types listed in the Feature Types text box. When we setup the Organism page above we placed 'gene' in this box. We'll leave this as is.
| + | |
| − | | + | |
| − | * Finally, to sync the features, click the 'Sync all Features' button. Rather than wait on the job cron we'll launch this job manually:
| + | |
| − | | + | |
| − | cd /var/www; php ./sites/all/modules/tripal_core/tripal_launch_jobs.php yeast_admin
| + | |
| − | | + | |
| − | '''Note''' This will probably take a bit of time. Check the status of the sync by navigating to the "Administer" → "Tripal Management" → "Jobs" page. It took about 8 minutes on my laptop.
| + | |
| − | | + | |
| − | === Themeing ===
| + | |
| − | While we wait for the features to sync we want to add the picture to the organism page. Go to the Yeast page, edit and add the <tt>Dry_yeast.jpg</tt> image to the page.
| + | |
| − | | + | |
| − | But, the image doesn't show up! There is a bug in the Tripal template file. So now is a good time to fix that and discuss theming.
| + | |
| − | | + | |
| − | Important Files for Drupal Themes:
| + | |
| − | * <tt>.info</tt> file
| + | |
| − | * <tt>screenshot.png</tt>
| + | |
| − | * <tt>logo.png</tt>
| + | |
| − | * <tt>style.css</tt>
| + | |
| − | * <tt>page.tpl.php</tt>
| + | |
| − | * customizations
| + | |
| − | | + | |
| − | cd /var/www/sites/all/themes/theme_tripal/
| + | |
| − | vi node-chado_organism.tpl.php
| + | |
| − | | + | |
| − | Change the line from this:
| + | |
| − | | + | |
| − | <img src=<?php print "sites/default/files/tripal/tripal_organism/images/".$node->genus."_".$node->species.".jpg"?>>
| + | |
| − | To this:
| + | |
| − | <img src=<?php print "/" . file_directory_path() . "/tripal/tripal_organism/images/".$node->genus."_".$node->species.".jpg"?>
| + | |
| − | | + | |
| − | Now, go to the organism page and refresh. The image should appear but it's layout is a bit awkward. We need to adjust the CSS file. Edit the CSS file:
| + | |
| − | | + | |
| − | cd /var/www/sites/all/themes/theme_tripal/css
| + | |
| − | vi tripal.css
| + | |
| − | | + | |
| − | Change this stanza:
| + | |
| − | //
| + | |
| − | // Copyright 2009 Clemson University
| + | |
| − | //
| + | |
| − | to this:
| + | |
| − | /*
| + | |
| − | Copyright 2009 Clemson University
| + | |
| − | */
| + | |
| − | | + | |
| − | The incorrect comments interferred with the first CSS stanza that affected table width.
| + | |
| − | | + | |
| − | Now, refresh the organism page and it should look correct.
| + | |
| − | | + | |
| − | ===Feature Syncing -- returned ===
| + | |
| − | Syncing should be finished, but if not we can continue. Here's what's new:
| + | |
| − | | + | |
| − | # The gene names on the organism page are now clickable
| + | |
| − | # (Click on a gene). The feature page for the gene now exists.
| + | |
| − | # Each feature has a URL identical to it's accession
| + | |
| − | | + | |
| − | | + | |
| − | Unfortunately, the [[GFF]] file loaded did not have sequence residues for the genes, so they are not appearing. Let's add the sequence to one sequence in particular. Browse for the 'YAL061W' feature on the Yeast page. Edit the feature and add the following sequences:
| + | |
| − | | + | |
| − | <pre>
| + | |
| − | ATGAGAGCCTTAGCGTATTTCGGTAAAGGTAACATCAGATTCACCAACCA
| + | |
| − | TTTAAAGGAGCCACATATTGTGGCGCCCGATGAGCTTGTGATTGATATCG
| + | |
| − | AATGGTGTGGTATTTGCGGTACGGACCTGCATGAGTACACAGATGGTCCT
| + | |
| − | ATCTTTTTCCCAGAAGATGGACACACACATGAGATTAGTCATAACCCATT
| + | |
| − | GCCACAGGCGATGGGCCACGAAATGGCTGGTACCGTTTTGGAGGTGGGCC
| + | |
| − | CTGGTGTGAAAAACTTGAAAGTGGGAGACAAGGTAGTTGTCGAGCCCACA
| + | |
| − | GGTACATGCAGAGACCGGTATCGTTGGCCCCTGTCGCCAAACGTTGACAA
| + | |
| − | GGAATGGTGCGCTGCTTGCAAAAAGGGCTACTATAACATTTGTTCATATT
| + | |
| − | TGGGGCTTTGTGGTGCGGGTGTGCAGAGCGGTGGATTTGCAGAACGTGTT
| + | |
| − | GTGATGAACGAATCTCACTGCTACAAAGTACCGGACTTCGTGCCCTTAGA
| + | |
| − | CGTTGCAGCTTTGATTCAACCGTTGGCTGTGTGCTGGCATGCAATTAGAG
| + | |
| − | TCTGCGAGTTCAAAGCAGGCTCTACGGCTTTGATCATTGGTGCTGGCCCC
| + | |
| − | ATCGGACTGGGCACGATACTGGCGTTGAACGCTGCAGGTTGCAAGGACAT
| + | |
| − | CGTCGTTTCAGAGCCTGCCAAGGTAAGAAGAGAACTGGCTGAAAAAATGG
| + | |
| − | GTGCCAGGGTTTACGACCCAACTGCGCACGCTGCCAAGGAGAGCATTGAT
| + | |
| − | TATCTGAGGTCGATTGCTGATGGTGGAGACGGCTTCGATTACACATTTGA
| + | |
| − | TTGCTCCGGGTTGGAAGTCACATTGAATGCTGCTATTCAGTGTCTCACTT
| + | |
| − | TCAGAGGCACCGCAGTGAACTTGGCCATGTGGGGCCATCACAAGATACAG
| + | |
| − | TTTTCTCCGATGGACATCACATTGCATGAAAGAAAGTACACAGGGTCCAT
| + | |
| − | GTGCTACACACACCACGATTTTGAGGCAGTAATAGAAGCTTTGGAAGAAG
| + | |
| − | GCAGGATTGACATTGATAGAGCAAGACATATGATAACGGGCAGAGTCAAC
| + | |
| − | ATTGAGGACGGCCTTGATGGCGCCATCATGAAGCTGATAAACGAGAAGGA
| + | |
| − | GTCTACAATCAAGATTATTCTGACTCCAAACAATCACGGAGAGTTGAACA
| + | |
| − | GGGAAGCCGATAATGAGAAGAAAGAAATTTCCGAGCTGAGCAGTCGGAAA
| + | |
| − | GATCAAGAAAGACTACGAGAATCAATAAACGAGGCTAAACTGCGTCACAC
| + | |
| − | ATGA
| + | |
| − | </pre>
| + | |
| − | '''Note:''' a bug exists (which has been fixed in CVS but not here) that won't let you select 'gene' as the feature type. To get past this just select 'EST' or 'contig'.
| + | |
| − | | + | |
| − | ===Feature References===
| + | |
| − | | + | |
| − | Notice on the page for the gene is a "References" Box. There should be a a reference to [[:Category:SGD|SGD]] and an accession number. We want to make the accession clickable.
| + | |
| − | | + | |
| − | Navigate to the PhPgAdmin page
| + | |
| − | | + | |
| − | http://localhost/phpPgAdmin-4.2.2/
| + | |
| − | | + | |
| − | Log in as the 'yeast_admin' user with password 'demo'. Open the chado_yeast database schema and find the 'db' table. Locate the 'SGD' entry and edit the row adding the following to the URL and URL prefix columns:
| + | |
| − | | + | |
| − | url: http://www.yeastgenome.org/
| + | |
| − | urlprefix: http://www.yeastgenome.org/cgi-bin/locus.fpl?dbid=
| + | |
| − | | + | |
| − | Now, return to the gene page and refresh the page. The accession should now be clickable and take you to the appropriate page on the SGD website for the gene.
| + | |
| − | | + | |
| − | '''Note''': In the future a Tripal module for managing these references will most likely be available.
| + | |
| − | | + | |
| − | == Blast Module -- An Analysis Example ==
| + | |
| − | Analysis modules can be created to display data in any way desired. Tripal currently has two analysis modules that may nor may not be useful to you.
| + | |
| − | | + | |
| − | Navigating to the "Administer" → "Site building" → "Modules" page and enable the Blast Analysis module.
| + | |
| − | | + | |
| − | The <tt>orf_coding.fasta</tt> file was blasted against the swissprot database. The results were saved in [[Glossary#XML|XML]] format. For this example only a single results will be used to save space on the VM. The CUGI script <tt>split_blastxml-0.1.2</tt> parses the XML file and generates a directory structure needed by the blast module.
| + | |
| − | | + | |
| − | We want to store results in the Blast analysis data directory:
| + | |
| − | | + | |
| − | cd /var/www/sites/default/files/tripal
| + | |
| − | sudo chown gmod tripal_analysis_blast
| + | |
| − | | + | |
| − | Now execute the script to generate the data format needed:
| + | |
| − | | + | |
| − | perl /home/gmod/tripal/packages/split_blastxml-0.1.2.pl \
| + | |
| − | -x /home/gmod/tripal/data/blast_demo.xml \
| + | |
| − | -l tripal_analysis_blast \
| + | |
| − | -h localhost \
| + | |
| − | -u yeast_admin \
| + | |
| − | -d chado_yeast \
| + | |
| − | -p demo \
| + | |
| − | -r 'DB:swissprot:display' \
| + | |
| − | -e "^(.*?)\s.*$"
| + | |
| − | | + | |
| − | Browse for the gene 'YAL061W' on the organism page and click. The page should show the blast results.
| + | |
| − | | + | |
| − | To disable the placement of blast results on the Feature pages, navigate to "Administer" → "Tripal Management" → "Analyses". Scroll down to the section titled "Tripal Blast" and uncheck the box. Return to the feature page and blast results should be gone.
| + | |
| − | | + | |
| − | | + | |
| − | '''Note''': It is anticipated that in the future a bulk data load will be available and helper scripts will not be needed.
| + | |
| − | | + | |
| − | ;Features
| + | |
| − | * Allows for storage of large blast results
| + | |
| − | * Does not clutter the [[Chado]] database unnecessarily
| + | |
| − | * Quick access
| + | |
| − | * Ajax enabled.
| + | |
| − | * Links to database
| + | |
| − | | + | |
| − | ;Restrictions
| + | |
| − | * Currently only supports NCBI nr, SwissProt and go-seqdb.
| + | |
| − | * Requires a helper script.
| + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | == Searching ==
| + | |
| − | We have a search box at the top of the page but we would like to add a menu item for searching. Navigate to the "Administer" → "Site building" → "Menus" → "Primary Links" page and click the 'Add Item' near the top of the page.
| + | |
| − | | + | |
| − | Enter the following into the fields
| + | |
| − | | + | |
| − | Path: search/node
| + | |
| − | Menu link title: Search
| + | |
| − | | + | |
| − | A new 'Search' tab appears in the main menu.
| + | |
| − | | + | |
| − | Check the status of the search indexing by navigating to "Administer" → "Site Configuration" → "Search Settings". For searching to work correctly the site must be 100% indexed. If not let's do that now by manually running the Drupal cron:
| + | |
| − | | + | |
| − | /usr/bin/wget -O - -q http://localhost/cron.php
| + | |
| − | | + | |
| − | However, due to timing issues, the search for the gene 'YAL061W' may or may not return a result. Additionally, in the blast results just added we need have the term 'Sorbitol dehydrogenase' to be searchable, but if we search on that enzyme we get zero results. We would like for both terms to be searchable. To do this, we need to reindex the features.
| + | |
| − | | + | |
| − | | + | |
| − | ;How to reindex all content
| + | |
| − | | + | |
| − | Navigate to "Administer" → "Tripal Management" → "Features" and click the 'Reindex all feature nodes' button. This will add a Job to Tripal.
| + | |
| − | | + | |
| − | Rather than wait for the Tripal Job cron to launch we will do it manually:
| + | |
| − | | + | |
| − | cd /var/www; php ./sites/all/modules/tripal_core/tripal_launch_jobs.php yeast_admin
| + | |
| − | | + | |
| − | Check the status of this job on the Jobs page.
| + | |
| − | | + | |
| − | '''Note:''' This will take a few minutes (3 minutes on my laptop)
| + | |
| − | | + | |
| − | We should now be able to search for both 'YAL061W' and 'Sorbitol dehydrogenase'.
| + | |
| − | | + | |
| − | Anytime major changes are made to the content on feature pages the feature should be re-indexed.
| + | |
| − | | + | |
| − | === Advanced Searching ===
| + | |
| − | | + | |
| − | Drupal uses "Taxonomy" to provide filtering of search results. In the case of this demo this level of advanced searching wouldn't make sense because we only have one organism and one feature type but we'll walk through how to do it.
| + | |
| − | | + | |
| − | An example of advanced searching with multiple taxonomy terms: http://www.marinegenomics.org/search or http://www.fagaceae.org/search
| + | |
| − | | + | |
| − | * First, navigate to the Search page and open the advanced options. It provides some default filtering mechanisms.
| + | |
| − | | + | |
| − | * Navigate to "Administer" → "Tripal Management" → "Features". Scroll down to the "Set Taxonomy" section and check the boxes "Organism Name" and "Feature Type" and click the button "Set/Reset Taxonomy for all feature nodes". This will create a Tripal job. Let's launch the job manually rather than wait for the cron to kick in.
| + | |
| − | | + | |
| − | cd /var/www; php ./sites/all/modules/tripal_core/tripal_launch_jobs.php yeast_admin
| + | |
| − | | + | |
| − | * Check the status of the job on the Tripal Jobs page. When 100% complete return to the Search page and refresh. You'll notice now a box for filtering search results by organism and by feature type. Search for the Feature 'YAL061W'. click on the result and scroll to the bottom of the page. You'll notice some "tags" have been added to the page. These are the Drupal taxonomy tags that have been assigned to the feature page.
| + | |
| − | | + | |
| − | * Navigate to "Administer" → "Content Management" → "Taxonomy". You'll see the new vocabularies and terms.
| + | |
| − | | + | |
| − | == Libraries & other Analysis ==
| + | |
| − | We do not have libraries for this example but they function in much the same way.
| + | |
| − | | + | |
| − | Subsets of features can be synced on the analysis and library administration pages when those modules are installed and features are associated in chado.
| + | |
| − | | + | |
| − | == Incorporate [[JBrowse]] ==
| + | |
| − | '''Exercise:'''
| + | |
| − | | + | |
| − | 1. Create a new page titled 'blast'
| + | |
| − | | + | |
| − | 2. Add the following in the body:
| + | |
| − | | + | |
| − | <iframe id="gbrowseFrame" width="100%" height="1500px" frameborder="0" src="/jbrowse/">
| + | |
| − | | + | |
| − | 3. Replace ??? with the URL for [[GBrowse]] created earlier in [[2009 GMOD Summer School - Americas|the week]].
| + | |
| − | | + | |
| − | 4. Set the Input type to Full HTML.
| + | |
| − | | + | |
| − | 5. Save the page.
| + | |
| − | | + | |
| − | 6. Create a menu item
| + | |
| − | | + | |
| − | This [[JBrowse]] won't contain to the sequence in our demo database but for purposes of demonstration this is adequate.
| + | |
| − | | + | |
| − | == Customizing Content ==
| + | |
| − | === Manipulating the Templates ===
| + | |
| − | Review [[Media:TripalUsersGuideJune2009.pdf|Users' Guide]] pg 28.
| + | |
| − | | + | |
| − | In the case of the organism template, the organism abbreviation is not present. This can easily be added by editing the <tt>node-chado_organism.tpl.php</tt> template file.
| + | |
| − | | + | |
| − | === Changing Base Themes ===
| + | |
| − | Review [[Media:TripalUsersGuideJune2009.pdf|Users' Guide]] pg 28.
| + | |
| − | | + | |
| − | Make the following changes to the tripal.info file in the <tt>./sites/all/themes/theme_tripal</tt> directory:
| + | |
| − | <pre>
| + | |
| − | name = Tripal Theme
| + | |
| − | description = A Tripal specific subtheme for use with any base theme. Requires customization to .info file for inclusion of the base theme and regions.
| + | |
| − | version = 6.x-0.1b
| + | |
| − | core = 6.x
| + | |
| − | engine = phptemplate
| + | |
| − | base theme = pushbutton // <-- changed
| + | |
| − | | + | |
| − | stylesheets[all][] = css/tripal.css
| + | |
| − | stylesheets[all][] = css/tripal_analysis_blast.css
| + | |
| − | stylesheets[all][] = css/tripal_organism.css
| + | |
| − | | + | |
| − | scripts[] = js/tripal.js
| + | |
| − | | + | |
| − | regions[header] = Header // <-- changed
| + | |
| − | regions[left] = Left // <-- changed
| + | |
| − | regions[right] = Right // <-- changed
| + | |
| − | regions[footer] = Footer // <-- changed
| + | |
| − | </pre>
| + | |
| − | <div class="emphasisbox">
| + | |
| − | But, there is a problem with this configuration file. If you change it, Tripal will get messed up. Restore <tt>tripal.info</tt> to it's original state:
| + | |
| − | </div>
| + | |
| − | <pre>
| + | |
| − | name = Tripal Theme
| + | |
| − | description = A Tripal specific subtheme for use with any base theme. Requires customization to .info file for inclusion of the base theme and regions.
| + | |
| − | version = 6.x-0.1b
| + | |
| − | core = 6.x
| + | |
| − | engine = phptemplate
| + | |
| − | base theme = admire_gray
| + | |
| − | | + | |
| − | stylesheets[all][] = css/tripal.css
| + | |
| − | stylesheets[all][] = css/tripal_analysis_blast.css
| + | |
| − | stylesheets[all][] = css/tripal_organism.css
| + | |
| − | | + | |
| − | scripts[] = js/tripal.js
| + | |
| − | | + | |
| − | regions[header] = Header
| + | |
| − | regions[sidebar_left] = Sidebar left
| + | |
| − | regions[content_top] = Content top
| + | |
| − | regions[sidebar_right] = Sidebar right
| + | |
| − | regions[footer_block] = Footer block
| + | |
| − | </pre>
| + | |
| − | Now, clear the cache. Navigate to "Administer" → "Site configuration" → "Performance". Click the "Clear cached data" button. That will tell Drupal to rebuild all pages from scratch.
| + | |
| − | | + | |
| − | Finally, we have to reset the blocks, but now we're using a new base theme and the Tripal theme is still present.
| + | |
| − | | + | |
| − | === Important Drupal Modules ===
| + | |
| − | ; Views
| + | |
| − | Awesome... won't go into detail but allow for customization of pages of aggregate data types.
| + | |
| − | | + | |
| − | ; CCK
| + | |
| − | Allow for adding new fields to existing data types... and more.
| + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | == Writing your own Module ==
| + | |
| − | '''Not yet in the [[Media:TripalUsersGuideJune2009.pdf|User's Guide]]'''
| + | |
| − | | + | |
| − | === Drupal API ===
| + | |
| − | ;Concepts
| + | |
| − | # The Tripal Core provides all necessary functionality to intergate with Tripal.
| + | |
| − | # Drupal API provide the rest
| + | |
| − | | + | |
| − | | + | |
| − | ;Anatomy of a Drupal module:
| + | |
| − | # module name (directory name)
| + | |
| − | # a .info file describing the module
| + | |
| − | # a .install file the gets executed when the modules if first installed and also when uninstalled.
| + | |
| − | # a .module file the code for the module.
| + | |
| − | # templates: the look-and-feel should be separated from the code if possible.
| + | |
| − | | + | |
| − | | + | |
| − | ;Example .info file: <tt>tripal_feature.info</tt>
| + | |
| − | | + | |
| − | name = Tripal Chado Feature
| + | |
| − | description = A module for interfacing the GMOD chado database with Drupal, providing viewing, inserting and editing of chado features.
| + | |
| − | core = 6.x
| + | |
| − | project = tripal_feature
| + | |
| − | package = Tripal
| + | |
| − | dependencies[] = tripal_core
| + | |
| − | dependencies[] = tripal_organism
| + | |
| − | dependencies[] = search
| + | |
| − | dependencies[] = path
| + | |
| − | version = "6.x-0.1b-m0.1"
| + | |
| − | | + | |
| − | | + | |
| − | ; Example .install file: <tt>tripal_feature.install</tt>
| + | |
| − | | + | |
| − | Drupal hooks:
| + | |
| − | {node}_{hook_name} or {module}_{hook_name}
| + | |
| − | | + | |
| − | | + | |
| − | The important functions:
| + | |
| − | * function ''tripal_feature_install()'': actions to do on install
| + | |
| − | * function ''tripal_feature_schema()'': returns the database schema so that Drupal knows what it is
| + | |
| − | * function ''tripal_feature_uninstall()'': actions for cleanup when the module is uninstalled
| + | |
| − | | + | |
| − | See the code here: <tt>/var/www/sites/all/modules/tripal_feature</tt>
| + | |
| − | | + | |
| − | | + | |
| − | ; Example .module file: <tt>tripal_feature.module</tt>
| + | |
| − | | + | |
| − | The important module-centric functions:
| + | |
| − | * function ''tripal_feature_admin()'': generates the administration form for the module.
| + | |
| − | * function ''tripal_feature_admin_validate($form, &$form_state)'': validates the admin form input.
| + | |
| − | * function ''tripal_feature_node_info()'': defines new nodes for Drupal (in this case chado_feature).
| + | |
| − | * function ''tripal_feature_perm()'': defines new permissions for the module.
| + | |
| − | * function ''tripal_feature_menu()'': defines new menu items
| + | |
| − | * function ''tripal_feature_theme()'': when theming must be handled by the module (e.g. search results).
| + | |
| − | * function ''tripal_feature_nodeapi(&$node, $op, $teaser, $page)'': used to place content on other nodes pages.
| + | |
| − | | + | |
| − | The important node-centric functions:
| + | |
| − | * function ''chado_feature_access($op, $node, $account)'': permission checking for the nodes
| + | |
| − | * function ''chado_feature_insert($node)'': code to execute on insert of a new node
| + | |
| − | * function ''chado_feature_delete($node)'': code to execute on delete of a node
| + | |
| − | * function ''chado_feature_update($node)'': code to execute on update of a new node
| + | |
| − | * function ''chado_feature_form ($node,$param)'': generates the form when editing or adding a new node
| + | |
| − | * function ''chado_feature_validate($node)'': validate the form input on insert or update.
| + | |
| − | * function ''chado_feature_load($node)'': loads the node data object when viewed
| + | |
| − | * function ''chado_feature_view ($node, $teaser = FALSE, $page = FALSE)'': set's in-module theming.
| + | |
| − | | + | |
| − | === Tripal API ===
| + | |
| − | Tripal provides the following functions for integrating with Tripal:
| + | |
| − | | + | |
| − | | + | |
| − | ; ''tripal_create_moddir($module_name)''
| + | |
| − | Every tripal module is expected to have it's own data directory. This directory gets created in the ./sites/default/data/tripal directory. This function creates that directory.
| + | |
| − | | + | |
| − | | + | |
| − | ; ''tripal_add_job ($job_name,$modulename,$callback,$arguments,$uid, $priority = 10)''
| + | |
| − | This function adds a new job is added to Tripal. An explanation of the argument is as follows:
| + | |
| − | * job_name: The name of the job as it appears to the user
| + | |
| − | * modulename: The name of the Tripal module submitting the job (e.g. tripal_feature, tripal_organism, etc).
| + | |
| − | * callback: The name of a function in the caller's module that should be called when the job is executed.
| + | |
| − | * arguments: An array of arguments to pass to the callback function when executed.
| + | |
| − | * uid: the user id of the user executing the job.
| + | |
| − | * priority: sets the priority of the job. The lower the number the higher the priority. Administrative jobs should always be 10 or less. User submitted jobs should always be above 10.
| + | |
| − | ''Note'': This function will always pass in the job id as the first argument to the callback function. Therefore all callback functions should have a jobid argument first.
| + | |
| − | | + | |
| − | | + | |
| − | ; ''tripal_job_set_progress($job_id,$percentage)''
| + | |
| − | Allows the callback function for the job to set the progress of the job. The first argument is the job id that get's passed into the callback by Tripal and the percentage is a value between 0 and 100.
| + | |
| − | | + | |
| − | | + | |
| − | ; ''tripal_get_module_active_jobs ($modulename)''
| + | |
| − | Allws a module to see if it has any active jobs currently executing. A list of jobs is returned.
| + | |
| − | | + | |
| − | | + | |
| − | ; ''tripal_add_cvterms ($name,$definition)''
| + | |
| − | Adds a CVterm to the chado database. Terms added using this function are added to the 'tripal' CV and associated with the 'tripal' database in chado. This function allows modules to create cvterms behind-the-scenes to support the data management they provide. This function is particularly useful in _install hooks of .install files.
| + | |
| − | | + | |
| − | | + | |
| − | ; ''function tripal_add_mview ($name,$modulename,$mv_table,$mv_specs,$indexed,$query,$special_index)''
| + | |
| − | Programatically adds a materialized view to chado. This view can then be used behind-the-scenes by the module to help speed data queries. This function is particularly useful in _install hooks of .install files. An explanation of the argument is as follows
| + | |
| − | | + | |
| − | * name: The name of the materialized view.
| + | |
| − | * modulename: The name of the module submitting the materailzed view (e.g. 'tripal_library')
| + | |
| − | * mv_table: The name of the table to add to chado. This is the table that can be queried.
| + | |
| − | * mv_specs: The table definition
| + | |
| − | * indexed: The columns that are to be indexed
| + | |
| − | * query: The SQL query that loads the materialized view with data
| + | |
| − | * special_index:
| + | |
| − | | + | |
| − | '''Note:''' These views are managed by Tripal and only the view itself is stored in Chado. This is different from the materialized views that comes with chado 1.0, although the outcome is the same. Any materialized views created with Tripal are not compatible with the Chado scripts for updating materialized views.
| + | |
| − | | + | |
| − | | + | |
| − | ; Adding a new analysis method
| + | |
| − | Not yet fully defined, however, the tripal_analysis module will provide a set of "core" functions for all analysis modules. Documentation and finalized analysis API coming soon.
| + | |
| − | | + | |
| − | | + | |
| − | === Exercise ===
| + | |
| − | ==== Setup ====
| + | |
| − | ;Step 1: Add a publication to [[Chado]]
| + | |
| − | Let's create a very simple module that will place publications on a feature page if an association exists in Chado. We won't be creating a data entry method so we'll have to manually add an example publication. Using phpPgAdmin, execute the following [[Glossary#SQL|SQL]] statements (together as a block):
| + | |
| − | | + | |
| − | <sql>
| + | |
| − | INSERT INTO cv (NAME) VALUES ('pub_demo');
| + | |
| − | | + | |
| − | INSERT INTO db (NAME) VALUES ('pub_demo');
| + | |
| − | | + | |
| − | INSERT INTO dbxref (db_id,accession,version,description)
| + | |
| − | VALUES ((SELECT db_id FROM db WHERE NAME = 'pub_demo'),
| + | |
| − | 'pub0001',' ','demo publication accession');
| + | |
| − | | + | |
| − | INSERT INTO cvterm (cv_id,name,dbxref_id)
| + | |
| − | VALUES ((SELECT cv_id FROM cv WHERE NAME = 'pub_demo'),
| + | |
| − | 'journal',
| + | |
| − | (SELECT dbxref_id FROM dbxref WHERE accession = 'pub0001'));
| + | |
| − | | + | |
| − | INSERT INTO pub (title,volumetitle,volume,issue,pyear,pages,uniquename,type_id)
| + | |
| − | VALUES ('Responses of pathogenic and nonpathogenic yeast species to steroids reveal the functioning and evolution of multidrug resistance transcriptional networks',
| + | |
| − | 'Eukaryot Cell','7','1','2008','68-77','demo_pub',
| + | |
| − | (SELECT cvterm_id FROM cvterm CVT INNER JOIN CV on CVT.cv_id = CV.cv_id
| + | |
| − | WHERE CV.name = 'pub_demo' AND CVT.name = 'journal'));
| + | |
| − | | + | |
| − | INSERT INTO pubauthor (pub_id,rank,surname,givennames)
| + | |
| − | VALUES ((SELECT pub_id FROM pub WHERE uniquename = 'demo_pub'),0,'Banerjee','et al.');
| + | |
| − | | + | |
| − | INSERT INTO feature_pub (feature_id,pub_id)
| + | |
| − | VALUES ((SELECT feature_id FROM feature WHERE uniquename = 'YAL061W'),
| + | |
| − | (SELECT pub_id FROM pub WHERE uniquename = 'demo_pub'));
| + | |
| − | </sql>
| + | |
| − | These statements do the following:
| + | |
| − | # Adds a db and cv. It's not real, but suits our purposes for the example.
| + | |
| − | # Adds a publication and author
| + | |
| − | # Associates the publication with the feature YAL061W.
| + | |
| − | | + | |
| − | ;Step 2: create the module directory
| + | |
| − | Change directories to our Drupal install directory where we installed the Tripal modules:
| + | |
| − | | + | |
| − | cd /var/www/sites/all/modules
| + | |
| − | | + | |
| − | Create a directory for our module. The directory name should be identical to our module name.
| + | |
| − | | + | |
| − | mkdir tripal_pubs
| + | |
| − | cd tripal_pubs
| + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | ==== Create tripal_pubs.info file ====
| + | |
| − | The first step to creating a module is to define our .info file that provides information to Drupal about our module.
| + | |
| − | | + | |
| − | Design considerations:
| + | |
| − | | + | |
| − | # Our module is dependent on the Tripal core (all modules are) and the Tripal feature (we want to tie our pubs to features).
| + | |
| − | # We want to add this module to the Tripal package.
| + | |
| − | | + | |
| − | Create a <tt>tripal_pubs.info</tt> file with the following content:
| + | |
| − | | + | |
| − | <pre>
| + | |
| − | ; $Id:
| + | |
| − | name = Tripal Pubs
| + | |
| − | description = A module for displaying publications on feature pages
| + | |
| − | core = 6.x
| + | |
| − | project = tripal_pubs
| + | |
| − | package = Tripal
| + | |
| − | version = 6.x-0.1b-m0.1
| + | |
| − | dependencies[] = tripal_core
| + | |
| − | dependencies[] = tripal_feature
| + | |
| − | </pre>
| + | |
| − | | + | |
| − | ==== Create tripal_pubs.install file ====
| + | |
| − | We do not have any functionality that needs to be performed when the module is installed, but we'll create a shell with proper drupal hooks so that in the future if we do want to add code to these modules we can.
| + | |
| − | <php>
| + | |
| − | <?php
| + | |
| − | //$Id:
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_install().
| + | |
| − | */
| + | |
| − | function tripal_pubs_install() {
| + | |
| − | }
| + | |
| − | | + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_uninstall().
| + | |
| − | */
| + | |
| − | function tripal_pubs_uninstall() {
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_schema().
| + | |
| − | */
| + | |
| − | function tripal_pubs_schema() {
| + | |
| − | $schema = array();
| + | |
| − | return $schema;
| + | |
| − | }
| + | |
| − | </php>
| + | |
| − | | + | |
| − | ==== Create the tripal_pubs.module file ====
| + | |
| − | Our module will be simple. It will add content to a feature page if there are publications associated with the feature. However, we'll add many important hooks for demonstration purposes.
| + | |
| − | | + | |
| − | Cut and paste the following code into a new tripal_pubs.module file. We'll discuss each function...
| + | |
| − | | + | |
| − | <php>
| + | |
| − | <?php
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_init()
| + | |
| − | */
| + | |
| − | function tripal_pubs_init() {
| + | |
| − | | + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_perm()
| + | |
| − | */
| + | |
| − | function tripal_pubs_perm(){
| + | |
| − | return array(
| + | |
| − | 'access chado_publication content',
| + | |
| − | 'create chado_publication content',
| + | |
| − | 'delete chado_publication content',
| + | |
| − | 'edit chado_publication content',
| + | |
| − | );
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_node_info()
| + | |
| − | */
| + | |
| − | function tripal_pubs_node_info() {
| + | |
| − | $nodes = array();
| + | |
| − | $nodes['chado_publication'] = array(
| + | |
| − | 'name' => t('Publications'),
| + | |
| − | 'module' => 'chado_publication',
| + | |
| − | 'description' => t('A publication from the chado database'),
| + | |
| − | 'has_title' => FALSE,
| + | |
| − | 'title_label' => t('Publication'),
| + | |
| − | 'has_body' => FALSE,
| + | |
| − | 'locked' => TRUE
| + | |
| − | );
| + | |
| − | return $nodes;
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_block()
| + | |
| − | */
| + | |
| − | function tripal_pubs_block($op = 'list', $delta = '0', $edit = array()){
| + | |
| − | switch($op){
| + | |
| − | case 'list':
| + | |
| − | $blocks[0]['info'] = t('Publications');
| + | |
| − | return $blocks;
| + | |
| − | | + | |
| − | case 'view':
| + | |
| − | if(user_access('access chado_publication content')){
| + | |
| − | $items[] = t("This block is not yet setup.");
| + | |
| − | $block['subject'] = t('Publications');
| + | |
| − | //We theme our array of links as an unordered list
| + | |
| − | $block['content'] = theme('item_list', $items);
| + | |
| − | }
| + | |
| − | return $block;
| + | |
| − | }
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_menu()
| + | |
| − | */
| + | |
| − | function tripal_pubs_menu() {
| + | |
| − | $items = array();
| + | |
| − | | + | |
| − | $items['publications'] = array(
| + | |
| − | 'menu_name' => ('primary-links'), //Enable the 'Publications' primary link
| + | |
| − | 'title' => t('Publications'),
| + | |
| − | 'page callback' => 'tripal_pubs_page',
| + | |
| − | 'access arguments' => array('access chado_publication content'),
| + | |
| − | 'type' => MENU_NORMAL_ITEM
| + | |
| − | );
| + | |
| − | // the administative settings menu
| + | |
| − | $items['admin/tripal/tripal_publication'] = array(
| + | |
| − | 'title' => 'Publications',
| + | |
| − | 'description' => 'Manage integration of Chado publications including associated features',
| + | |
| − | 'page callback' => 'drupal_get_form',
| + | |
| − | 'page arguments' => array('tripal_pubs_admin'),
| + | |
| − | 'access arguments' => array('administer site configuration'),
| + | |
| − | 'type' => MENU_NORMAL_ITEM,
| + | |
| − | );
| + | |
| − | return $items;
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_admin()
| + | |
| − | */
| + | |
| − | function tripal_pubs_admin () {
| + | |
| − | // provide a form for administrative settings
| + | |
| − | $form = array();
| + | |
| − | | + | |
| − | return system_settings_form($form);
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_admin_validate()
| + | |
| − | */
| + | |
| − | function tripal_pubs_admin_validate($form, &$form_state) {
| + | |
| − | // validate the admin form submission
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_insert()
| + | |
| − | */
| + | |
| − | function chado_publication_insert($node){
| + | |
| − | // add publication to chado database
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_delete()
| + | |
| − | */
| + | |
| − | function chado_publication_delete($node){
| + | |
| − | // remove publication from chado database
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_update()
| + | |
| − | */
| + | |
| − | function chado_publication_update($node){
| + | |
| − | // update a publication record in the chado database
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_access()
| + | |
| − | */
| + | |
| − | function chado_publication_access($op, $node, $account){
| + | |
| − | if ($op == 'create') {
| + | |
| − | return user_access('create chado_publication content', $account);
| + | |
| − | }
| + | |
| − | | + | |
| − | if ($op == 'update') {
| + | |
| − | if (user_access('edit chado_publication content', $account)) {
| + | |
| − | return TRUE;
| + | |
| − | }
| + | |
| − | }
| + | |
| − | if ($op == 'delete') {
| + | |
| − | if (user_access('delete chado_publication content', $account)) {
| + | |
| − | return TRUE;
| + | |
| − | }
| + | |
| − | }
| + | |
| − | if ($op == 'view') {
| + | |
| − | if (user_access('access chado_publication content', $account)) {
| + | |
| − | return TRUE;
| + | |
| − | }
| + | |
| − | }
| + | |
| − | return FALSE;
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_form()
| + | |
| − | */
| + | |
| − | function chado_publication_form ($node, $param){
| + | |
| − | $form = array();
| + | |
| − | | + | |
| − | $form['title']= array(
| + | |
| − | '#type' => 'textfield',
| + | |
| − | '#title' => t('Publication Title'),
| + | |
| − | '#required' => TRUE,
| + | |
| − | '#default_value' => ' ',
| + | |
| − | '#description' => t('Enter the title for the publication'),
| + | |
| − | '#weight' => 1,
| + | |
| − | '#maxlength' => 255
| + | |
| − | );
| + | |
| − | | + | |
| − | // add additional fields to the form that are needed to populate the
| + | |
| − | // chado tables
| + | |
| − | | + | |
| − | return $form;
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_load()
| + | |
| − | */
| + | |
| − | function chado_publication_load($node){
| + | |
| − | $previous_db = db_set_active('chado'); // use chado database
| + | |
| − | $sql = "SELECT * ".
| + | |
| − | "FROM pub P ";
| + | |
| − | $pubs = db_fetch_object(db_query($sql));
| + | |
| − | db_set_active($previous_db); // now use drupal database
| + | |
| − | | + | |
| − | $additions->pubs = $pubs;
| + | |
| − | | + | |
| − | // we would additionally want to pull out the authors for the publication
| + | |
| − | // as well
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_view()
| + | |
| − | */
| + | |
| − | function chado_publication_view ($node, $teaser = FALSE, $page = FALSE) {
| + | |
| − | // this function provides instructions for establishing the way the
| + | |
| − | // publication page will look.
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Callback for the 'publications' menu item
| + | |
| − | */
| + | |
| − | function tripal_pubs_page(){
| + | |
| − | return 'This is where custom content would go if we needed it.';
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_nodeapi()
| + | |
| − | */
| + | |
| − | function tripal_pubs_nodeapi(&$node, $op, $teaser, $page) {
| + | |
| − | switch ($op) {
| + | |
| − | case 'view':
| + | |
| − | // Abort if this node is not one of the types we should show.
| + | |
| − | if (strcmp($node->type,'chado_feature') != 0) {
| + | |
| − | break;
| + | |
| − | }
| + | |
| − | | + | |
| − | // Add pubs to the content item if it's not a teaser
| + | |
| − | if (!$teaser && $node->feature->feature_id) {
| + | |
| − | $node->content['tripal_pubs_form'] = array(
| + | |
| − | '#value' => theme('tripal_pubs_feature_pub_list', $node),
| + | |
| − | '#weight' => 4
| + | |
| − | );
| + | |
| − | }
| + | |
| − | }
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * Implementation of hook_theme()
| + | |
| − | */
| + | |
| − | function tripal_pubs_theme () {
| + | |
| − | return array(
| + | |
| − | 'tripal_pubs_feature_pub_list' => array (
| + | |
| − | 'arguments' => array('node'),
| + | |
| − | )
| + | |
| − | );
| + | |
| − | }
| + | |
| − | | + | |
| − | /*******************************************************************************
| + | |
| − | * The theme function that sets the content to be added
| + | |
| − | */
| + | |
| − | function theme_tripal_pubs_feature_pub_list ($node) {
| + | |
| − | $feature = $node->feature;
| + | |
| − | | + | |
| − | // get the list of publications that are associated with this
| + | |
| − | // feature
| + | |
| − | $sql = "SELECT * ".
| + | |
| − | "FROM pub P ".
| + | |
| − | " INNER JOIN feature_pub FP ON FP.pub_id = P.pub_id ".
| + | |
| − | "WHERE FP.feature_id = %d";
| + | |
| − | $previous_db = db_set_active('chado'); // use chado database
| + | |
| − | $pubs = db_query($sql,$feature->feature_id);
| + | |
| − | db_set_active($previous_db); // now use drupal database
| + | |
| − | // generate the content that will appear on the feature page
| + | |
| − | // first we'll make the normal Tripal expandable box for this
| + | |
| − | // content to go into
| + | |
| − | $content = "< div id=\"feature-pubs\" class=\"feature-pubs-box\">".
| + | |
| − | "< div class=\"tripal_expandableBox\">".
| + | |
| − | "< h3>Publications</h3></div>".
| + | |
| − | "< div class=\"tripal_expandableBoxContent\" ".
| + | |
| − | "id=\"pubs_$feature->feature_id\">";
| + | |
| − | | + | |
| − | // iterate through the publications, get the authors and print
| + | |
| − | // the references
| + | |
| − | while($pub = db_fetch_object($pubs)){
| + | |
| − | $sql = "SELECT * FROM pubauthor WHERE pub_id = %d";
| + | |
| − | $previous_db = db_set_active('chado'); // use chado database
| + | |
| − | $authors = db_query($sql,$pub->pub_id);
| + | |
| − | db_set_active($previous_db); // now use drupal database
| + | |
| − | while ($author = db_fetch_object($authors)){
| + | |
| − | $content .= "$author->surname, $author->givennames; ";
| + | |
| − | }
| + | |
| − | $content .= "$pub->title. <em>$pub->volumetitle</em> $pub->pyear $pub->volume($pub->issue):$pub->pages< br>";
| + | |
| − | }
| + | |
| − | $content .= "</div>< br>";
| + | |
| − | | + | |
| − | return $content;
| + | |
| − | }
| + | |
| − | </php>
| + | |
| − | '''Note'''... fix the < div> and < h3>tags in the function immediately above and remove the spaces. Mediawiki was giving problems with these so they should be fixed.
| + | |
| | | | |
| | + | [[Category:Tripal]] |
| | [[Category:BLAST]] | | [[Category:BLAST]] |
| | [[Category:Tutorials]] | | [[Category:Tutorials]] |
