NOTE: We are working on migrating this site away from MediaWiki, so editing pages will be disabled for now.
GMOD Online Training 2014/GBrowse syn Tutorial
This tutorial on GBrowse syn was taught by Sheldon McKay as part of the GMOD_Online_Training_2014.
The starting image for this tutorial is GMOD 2014 online school - ami-907e97f8. It can be run as a micro or small instance.
- If you are not using the Amazon EC2 instance, the system paths may vary from those described below.
GBrowse_syn is a GBrowse-based synteny browser designed to display multiple genomes, with a central reference species compared to two or more additional species. It is included with the standard GBrowse package (version 1.69 and later).
Contents
GBrowse_syn Introduction
Introductory talk on GBrowse_syn
Installing GBrowse_syn
GBrowse_syn is part of the GBrowse2 package and was pre-installed when you went through the GBrowse 2.0 installation.
Update GBrowse to get recent changes:
1) Get a copy of the Gbrowse github repository
$ git clone https://github.com/GMOD/GBrowse.git
Cloning into 'GBrowse'... remote: Reusing existing pack: 40784, done. remote: Total 40784 (delta 0), reused 0 (delta 0) Receiving objects: 100% (40784/40784), 26.98 MiB | 5.93 MiB/s, done. Resolving deltas: 100% (25613/25613), done.
2) Clean up the synteny conf folder (the may be some older junk lying around)
$ sudo rm -f /data/etc/gbrowse2/synteny/*
3) Upgrade GBrowse
$ cd ~/GBrowse $ ./Build.PL
While running the command below:
- Select /data/etc/gbrowse2/ when prompted (instead of /etc/gbrowse2)
- Select R (Replace) when prompted |
$ sudo ./Build install
4) Create a symbolic link to the GBrowse temp folder (for caching of sessions, images, etc)
$ cd /var/www $ ln -s ../tmp
Running GBrowse for the First Time
Point your browser to http://ec2-##-##-##-##.compute-1.amazonaws.com/cgi-bin/gb2/gbrowse_syn
This is the welcome screen you should see after installing a new copy of GBrowse_syn with no configured data sources. It contains instructions on how to set up the example data source provided with the distribution.
Setting up the sample data
- Sample data and configuration information for GBrowse_syn come pre-packaged with GBrowse.
- The example we will use is a two-species comparison of rice (Oryza sativa) and one of its wild relatives*
Setting up the Alignment Database
The alignment, or joining database will contain the sequence alignments between the two rice species. It will be in a MySQL database. If mysql is not installed on your server, you can install it as follows:
Debian-based Linux distributions:
$ sudo apt-get update $ sudo apt-get install mysql-server mysql-client
RedHat-based Linux distributions
$ sudo yum install mysql
Note: You set the mysql root password at the time of installation. Use 'gbsyndemo' or else be sure to remember the password for use later.
1) Create a MySQL database to hold the alignment data
$ mysql -u root -p Enter password: ****************
Welcome to the MySQL monitor. Commands end with ; or \g. Your MySQL connection id is 37 Server version: 5.1.37-1ubuntu5.1 (Ubuntu) Type 'help;' or '\h' for help. Type '\c' to clear the current input statement. mysql> create database rice_synteny; Query OK, 1 row affected (0.00 sec) mysql>
2) Give read-only (SELECT privileges in SQL) to the default apache user www-data. We can do this for all of the MySQL databases, since they are all for web applications
mysql> GRANT SELECT on *.* TO 'www-data'@'localhost';
Query OK, 0 rows affected (0.00 sec)
mysql> quit
3) Load the sample alignment database. You need to have root-level access (be a sudoer) for some of the steps below.
$ cd /data/var/lib/gbrowse2/databases/gbrowse_syn/alignments
Have a look at the first few lines of the data:
$ zcat rice.aln.gz | head -20
CLUSTAL W(1.81) multiple sequence alignment W(1.81) rice-3(+)/16598648-16600199 ggaggccggccgtctgccatgcgtgagccagacggggcgggccggagacaggccacgtgg wild_rice-3(+)/14467855-14469373 gggggccgg------------------------------------agacaggccacgtgg ** ****** *************** rice-3(+)/16598648-16600199 ccctgccccgggctgttgacccactggcacccctgtcccgggttgtcgccctcctttccc wild_rice-3(+)/14467855-14469373 ccctgccccgggctgttgacccactggcacccctgtcccgggttgtcgccctcctttccc ************************************************************ rice-3(+)/16598648-16600199 cgccatgctctaagtttgctcctcttctcgaacttctctctttgattcttcacgtcctct wild_rice-3(+)/14467855-14469373 cgccatgctctaagtttgctcctcttctcgaacttctctctttgattcttcacgtcctct ************************************************************ rice-3(+)/16598648-16600199 tggagcctccccttctagctcgatcacgctctgctcttccgcttggaggctggcaaaact wild_rice-3(+)/14467855-14469373 tggagcctccccttctagctcgatcgcgctctgctcttccgcttggaggctggcaaaact
The format is CLUSTALW. This is a formatting convention; it does not mean CLUSTALW was used to generate the alignment data. See Further Reading below for more information on data loading and the meta-data in the sequence names
Load the database with the script gbrowse_syn_load_alignments_msa.pl, which is automatically installed along with GBrowse. See the [GBrowse_syn scripts] page for details on the options for the script.
$ zcat rice.aln.gz | gbrowse_syn_load_alignments_msa.pl -u root -p ******* -d rice_synteny -c -v -
There are 185 alignment blocks, it takes a moment to load
Setting up the Configuration Files
- The configuration files required for this data source are pre-installed with GBrowse, in /data/etc/gbrowse2/synteny/.
- There are config files for two species, rice_synteny.conf and wild_rice_synteny.conf, and the joining config file, oryza.synconf. The latter file has been disabled by appending a '.disabled' extension to the file name.
The joining config file, oryza.synconf:
[GENERAL] description = BLASTZ alignments for Oryza sativa ====Sample Configuration Files==== # The synteny database join = dbi:mysql:database=rice_synteny;host=localhost # This option maps the relationship between the species data sources, names and descriptions # The value for "name" (the first column) is the symbolic name that gbrowse_syn users to identify each species. # This value is also used in two other places in the gbrowse_syn configuration: # the species name in the "examples" directive and the species name in the .aln file # The value for "conf. file" is the basename of the corresponding gbrowse .conf files. # This value is also used to identify the species configuration stanzas at the bottom of the configuration file. # name conf. file Description source_map = rice rice_synteny "Domesic Rice (O. sativa)" wild_rice wild_rice_synteny "Wild Rice" tmpimages = /tmp/gbrowse2 imagewidth = 800 stylesheet = /gbrowse2/css/gbrowse_transparent.css cache time = 1 config_extension = conf # example searches to display examples = rice 3:16050173..16064974 wild_rice 3:1..400000 zoom levels = 5000 10000 25000 50000 100000 200000 400000 # species-specific databases [rice_synteny] tracks = EG color = blue [wild_rice_synteny] tracks = EG color = red
A sample species config file, rice_synteny.conf:
[GENERAL] description = Domestic rice chromosome 3 db_adaptor = Bio::DB::SeqFeature::Store db_args = -adaptor memory -dir /var/www/gbrowse2/databases/gbrowse_syn/rice # Web site configuration info tmpimages = /tmp/gbrowse2 [EG] feature = gene:ensembl glyph = gene height = 10 bgcolor = peachpuff fgcolor = hotpink description = 0 label = 0 category = Transcripts key = ensembl gene balloon hover = Hello, my name is $name!
Note: the species databases are actually using the GFF3 flat file, in-memory adapter
Activating the Oryza Data Source
1) Renaming the configuration file
$ cd /data/etc/gbrowse2/synteny $ sudo mv oryza.synconf.disabled.conf oryza.synconf
3) Point your browser to http://ec2-##-##-##-##.compute-1.amazonaws.com/cgi-bin/gb2/gbrowse_syn/oryza (or your own URL if you are not using the Amazon EC2 instance). You should see:
4) Click on the first example, you should (eventually) see:
5) Try out a few user interface features:
- mouse over one of the genes:
- Click on one of the bold blue highlighted section titles. This takes you to a contextual help page on the GMOD wiki.
Speeding up the Browser
You can speed up the image loading time by putting your species' GFF3 data into relational MySQL databases.
1) Create a database for each of the GFF data files (rice.gff3 and wild_rice.gff3).
$ mysql -uroot -pgbsyndemo
mysql> create database rice;
Query OK, 1 row affected (0.00 sec)
mysql> create database wild_rice;
Query OK, 1 row affected (0.00 sec)
mysql> quit
2) Populate the databases using the Loading bp_seqfeature_load (pre-installed as part of BioPerl with GBrowse). This will load the GFF3 data into a MySQL relational database. Note the MySQL user will root-level privileges.
$ cd /var/lib/gbrowse2/databases/gbrowse_syn/rice $ bp_seqfeature_load -u root -p gbsyndemo -d rice -c -f rice.gff3 loading rice.gff3... Building object tree... 0.55s0s
Loading bulk data into database... 0.73s load time: 11.99s
$ cd ../wild_rice $ bp_seqfeature_load -u root -p gbsyndemo -d wild_rice -c -f wild_rice.gff3 loading wild_rice.gff3... Building object tree... 0.55s7a
Loading bulk data into database... 0.69s load time: 12.02s
3) Modify the following stanza in the file rice_synteny.conf in cd /etc/gbrowse2/synteny/. This will convert your data source from a flat file database to a MySQL relational database.
# from db_args = -adaptor memory -dir /var/www/html/gbrowse/databases/gbrowse_syn/rice
# to db_args = -adaptor DBI::mysql -dsn dbi:mysql:rice
4) repeat for wild_rice_synteny.conf
Using Non-alignment Data
This example uses gene orthology-based synteny blocks* based created by OrthoCluster for three nematode species, C. elegans, C. briggsae and P. pacificus.
1) Download and unpack the data archive file orthocluster.tar.gz.
$ mkdir ~/data $ cd data $ wget ftp://ftp.gmod.org/pub/gmod/GBrowse_syn/orthocluster.tar.gz $ tar zxvf orthocluster.tar.gz ORTHOCLUSTER/ ORTHOCLUSTER/conf/ ORTHOCLUSTER/gff/ ORTHOCLUSTER/orthocluster.txt ORTHOCLUSTER/gff/bri.gff3 ORTHOCLUSTER/gff/ele.gff3 ORTHOCLUSTER/gff/ppa.gff3 ORTHOCLUSTER/conf/bri.conf ORTHOCLUSTER/conf/ele.conf ORTHOCLUSTER/conf/orthocluster.synconf ORTHOCLUSTER/conf/ppa.conf
Species Gene Annotations
In the gff directory, there are GFF3 annotations for three species
$ head -20 ele.gff3
##gff-version 3 ##sequence-region I 1 15072421 ##sequence-region II 1 15279324 ##sequence-region III 1 13783685 ##sequence-region IV 1 17493784 ##sequence-region V 1 20924143 ##sequence-region X 1 17718854 IV curated mRNA 11012483 11015853 . - . ID=F13H10.3a;Name=F13H10.3a IV curated CDS 11012483 11012648 . - 1 Parent=F13H10.3a IV curated CDS 11012694 11012932 . - 0 Parent=F13H10.3a IV curated CDS 11013456 11013667 . - 2 Parent=F13H10.3a IV curated CDS 11013719 11013817 . - 2 Parent=F13H10.3a IV curated CDS 11013878 11014105 . - 2 Parent=F13H10.3a IV curated CDS 11014195 11014434 . - 2 Parent=F13H10.3a IV curated CDS 11014489 11014646 . - 1 Parent=F13H10.3a IV curated CDS 11014695 11014792 . - 0 Parent=F13H10.3a IV curated CDS 11014841 11015114 . - 1 Parent=F13H10.3a IV curated CDS 11015624 11015724 . - 0 Parent=F13H10.3a IV curated CDS 11015821 11015853 . - 0 Parent=F13H10.3a II curated mRNA 2824413 2824910 . + . ID=K12H6.9;Name=K12H6.9
2) Create a new data for C. elegans
$ mysql -uroot -pgbsyndemo -e 'create database ele'
3) Create and load a Bio::DB:SeqFeature::Store database for C. elegans (ele).
We use screen so that we can get the time-consuming loading script started and then use Ctrl-A D to set the screen running in the background' and move on to other steps.
$ screen bp_seqfeature_load -u root -p gbsyndemo -d ele -c -f ele.gff3
4) Repeat steps 2 and 3 for the other two species (bri and ppa).
Configurations Files
The conf has configuration files for each of the species and the alignment database.
Example species configuration:
[GENERAL] description = C. briggsae db_adaptor = Bio::DB::SeqFeature::Store db_args = -dsn dbi:mysql:bri tmpimages = /tmp/gbrowse2 [CG] label = 1 description = 1 feature = mRNA category = Genes glyph = processed_transcript font2color = blue height = 6 key = Gene Models bgcolor = sub { my $flip = pop->panel->flip; my $strand = shift->strand; return $strand < 0 ? 'violet' : 'turquoise' if $flip; return $strand > 0 ? 'violet' : 'turquoise'; } # draw genes differently for segments > 100Kb [CG:100001] label = 0 description = 0 glyph = generic strand_arrow = 1
The alignment configuration:
[GENERAL] description = OrthoCluster Perfect Synteny Blocks # The synteny database join = dbi:mysql:orthocluster # symbolic src config file (".conf") Description source_map = ele ele "C. elegans" bri bri "C. briggsae" ppa ppa "P. pacificus" # web site configuration info tmpimages = /tmp/gbrowse2 imagewidth = 800 stylesheet = /gbrowse2/css/gbrowse_transparent.css # The extension of species config files # can also use .syn (the default) config_extension = conf # sparse data, use all coordinates grid coordinates = exact # example searches to display examples = ele X:402000..426999 bri chrX:255000..275000 zoom levels = 5000 10000 25000 50000 100000 200000 400000 1000000 # species-specific databases [ele] tracks = CG color = green [bri] tracks = CG color = blue [ppa] tracks = CG color = red
5) Install the configuration files
$ cd ~/data/ORTHOCLUSTER/conf $ sudo cp *.conf /data/etc/gbrowse2/synteny
The Alignment Data
The file orthocluster.txt contains the synteny data. The first few lines are shown below. The first 12 fields in each row specify information about the synteny block in each species and the series of numbers are orthologous gene coordinate pairs that are used for linking orthologs with grid-lines in the GBrowse_syn display. See 'Alignment Data' under Further Reading below for more details of this loading format.
bri chrI 176154 183558 + . ppa Ppa_Contig88 27212 30786 + . 176154 27212 177594 30786 182118 27212 183558 30786 | 30786 183558 27212 182118 30786 177594 27212 176154 bri chrI 778780 799223 + . ppa Ppa_Contig88 533454 542961 - . 778780 539924 786778 542961 789497 533454 799223 538726 | 538726 799223 533454 789497 542961 786778 539924 778780 bri chrI 986150 994698 + . ppa Ppa_Contig77 29481 45600 - . 986150 37055 989649 45600 991428 29481 994698 36608 | 36608 994698 29481 991428 45600 989649 37055 986150 bri chrI 1453793 1461931 + . ppa Ppa_Contig132 156183 165414 - . 1453793 163110 1456404 165414 1456712 160849 1457637 162712 1458361 160204 1459245 160815 1459468 159346 1459854 160000 1459962 156183 1461931 159022 | 159022 1461931 156183 1459962 160000 1459854 159346 1459468 160815 1459245 160204 1458361 162712 1457637 160849 1456712 165414 1456404 163110 1453793
6) Create and load the alignment the alignment database. The gbrowse_syn_load_alignment_database.pl script is pre-installed with GBrowse.
$ cd .. $ mysql -uroot -pgbsyndemo -e 'create database orthocluster' $ gbrowse_syn_load_alignment_database.pl -u root -p gbsyndemo -d orthocluster -c -v orthocluster.txt
7) Go back to your browser and reload the rice page. There should now be a second data source in a pull-down menu.
8) Select the other data source and start browsing!
Further Reading
A Note on Whole Genome Alignments
The focus of the section of the course is on dealing with alignment or synteny data and using GBrowse_syn. However, how to generate whole genome alignments, identify orthologous regions, etc., are the subject of considerable interest, so some background reading is listed below:
- Primer on Hierarchical Genome Alignment Strategies
- article on PECAN and ENREDO
- all about PECAN
- The gene annotations for each species are in GFF files.
- The alignment data are in a constrained CLUSTALW format (They were not generated by the program CLUSTALW, which is not necessarily suitable for whole genome alignments)
- There are processing steps for the alignment data but it is very computationally intensive and we will load pre-processed data to get a head start.
Documentation
There is detailed documentation on the GMOD wiki for how to install, configure and use GBrowse_syn. To get started, browse these pages: