GBrowse Backends

From GMOD
Jump to: navigation, search

This page describes the GBrowse database back ends. It is incomplete.

Contents

The Bio::DB::SeqFeature::Store Adaptor

This is a quick and easy adaptor to use. It allows you to load both GFF2 and GFF3 formatted files, and provides storage via flat files, BerkeleyDB-formatted files, and MySQL and PostgreSQL databases.

The GFF3 Format

An increasing number of model organism databases are distributing genome annotation in GFF3 format. An example of this format can be found at SGD.

Using Bio::DB::SeqFeature::Store with Flat Files

Create a directory somewhere on the filesystem that is readable by the Apache web server. Copy into it one or more GFF3 files containing annotations for the genome of interest.

Create a datasource-specific configuration file for GBrowse with a [database] stanza like this one:

[my_data:database]
db_adaptor = Bio::DB::SeqFeature::Store
db_args    = -adaptor memory
             -dir     /path/to/your/database/directory

The db_adaptor option loads the Bio::DB::SeqFeature::Store module. The db_args' option passes arguments to the module, namely to use the "memory" backend (store features into memory) from flat files located at "/path/to/your/database/directory".

The configuration file's [GENERAL] section should contain the entry "database = my_data".

If you wish to create tracks that display or manipulate DNA sequences, you will need to add FASTA files to this directory. The FASTA files should have one DNA entry for each chromosome, contig, or other sequence used as reference points by the GFF3 files. For example:

>chr1
CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACCCACACACACA
CATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTGGCCAACCTGTCTCTCAACTT
ACCCTCCATTACCCTGCCTCCACTCGTTACCCTGTCCCATTCAACCATACCACTCCGAAC
CACCATCCATCCCTCTACTTACTACCACTCACCCACCGTTACCCTCCAATTACCCATATC
...
>chr2
ATATTCTATACGGCCCGACGCGACGCGCCAAAAAATGAAAAACGAAGCAGCGACTCATTT
TTATTTAAGGACAAAGGTTGCGAAGCCGCACATTTCCAATTTCATTGTTGTTTATTGGAC
ATACACTGTTAGCTTTATTACCGTCCACGTTTTTTCTACAATAGTGTAGAAGTTTCTTTC
TTATGTTCATCGTATTCATAAAATGCTTCACGAACACCGTCATTGATCAAATAGGTCTAT
...

Because the Bio::DB::SeqFeature::Store adaptor automatically creates an index to speed up retrieval of DNA sequence, you will need to make the directory that contains the GFF3 and FASTA files writeable by the Apache user. For instance, if Apache runs as the user "www-data", then you will need to do:

sudo chown www-data /path/to/your/database/directory

It might be preferable to create a special group named "gbrowse", add yourself and the Apache user to that group, assign the database directory to the "gbrowse" group, and then make the directory group writeable:

sudo addgroup gbrowse
sudo adduser $USER gbrowse
sudo adduser www-data gbrowse
sudo chgrp gbrowse /path/to/your/database/directory
sudo chmod g+rwx /path/to/your/database/directory

Using Bio::DB::SeqFeature::Store with the BerkeleyDB Backend

If your GFF3 files get much larger than a 1000 features or so, GBrowse will begin to slow down. You can increase performance by using the BerkeleyDB backend. In exactly the way that you did with the in-memory version, set up a database directory containing to be writeable by the Apache user and copy into it all the GFF3 and FASTA files you wish to add to the database. Set the db_args of the datasource database section to read as follows:


[my_data:database]
db_adaptor = Bio::DB::SeqFeature::Store
db_args    = -adaptor berkeleydb
             -dir     /path/to/your/database/directory

The next time you access the datasource, there will be a delay while the database indexes are built. This delay may be quite long, so do not interrupt loading by pressing the "Cancel" button. After the indexes are built, access will be quite fast. You may add and edit GFF3 and FASTA files at any time, and the indexes will be rebuilt as necessary.

Note that for the BerkeleyDB backend to work at all, the database directory must be writeable by the Apache user.

Using Bio::DB::SeqFeature::Store with the MySQL Backend

More preparation is required for this backend. You will need to use the mysql command-line tool to create a new empty database, grant yourself all privileges on the database, and grant the Apache user SELECT access to the database:

mysql -uroot -p password -e 'create database genomegff3'
mysql -uroot -p password -e 'grant all privileges on genomegff3.* to me@localhost'
mysql -uroot -p password -e 'grant select on genomegff3.* to apache@localhost'

Now you will use the bp_seqfeature_load.pl command (installed when you installed BioPerl) to load GFF3 and FASTA files:

bp_seqfeature_load.pl -d genomegff3 -f -c genome1.gff3 genome2.gff3 genome3.fa

In the [database] section of the datasource-specific configuration file, enter a database configuration like the following:

db_adaptor    = Bio::DB::SeqFeature::Store
db_args       = -adaptor DBI::mysql
                -dsn     dbi:mysql:database=genomegff3
                -user    apache

The database should now be browsable.

The Bio::DB::GFF Adaptor

This step takes you through populating the database with the full yeast genome. You can skip this step if you use the in-memory database for small projects.

Synopsis

     mysql -uroot -ppassword -e 'create database yeast'
     mysql -uroot -ppassword -e 'grant all privileges on yeast.* to me@localhost'
     mysql -uroot -ppassword -e 'grant file on *.* to me@localhost'
     mysql -uroot -ppassword -e 'grant select on yeast.* to nobody@localhost'
     bp_bulk_load_gff.pl -d yeast sample_data/yeast_data.gff

Details

Note: This section refers to the user account under which Apache runs as "nobody" because that is the most common case. However, many systems use a different user account. Mac OSX uses "www", Fedora Core uses "apache" and Ubuntu uses "www-data." In the instructions that follow, replace 'nobody' with the appropriate Apache account name.

You will need an installation of MySQL for this section. Using the mysql command line, create a database (called "yeast" in the synopsis above), and ensure that you have update and file privileges on it. The example above assumes that you have a username of "me" and that you will allow updates from the local machine only. It also gives all privileges to "me". You may be comfortable with a more restricted set of privileges, but be sure to provide at least SELECT, UPDATE and INSERT privileges. You will need to provide the administrator's name and correct password for these commands to succeed.

In addition, grant the "nobody" user the SELECT privilege. The web server usually runs as nobody, and must be able to make queries on the database. Modify this as needed if the web server runs under a different account.

The next step is to load the database with data. This is accomplished by loading the database from a tab-delimited file containing the genomic annotations in GFF format. The BioPerl distribution comes with three tools for loading Bio::DB::GFF databases:

bp_load_gff.pl
This will incrementally load a database, optionally initializing it if it does not already exist. This script will work correctly even if the MySQL server is located on another host.
bp_bulk_load_gff.pl
This Perl script will initialize a new Bio::DB::GFF database with a fresh schema, deleting anything that was there before. It will then load the file. Only suitable for use the very first time you create a database, or when you want to start from scratch! The bulk loader is as much as 10x faster than bp_load_gff.pl, but does not work in the situation in which the MySQL database is running on a remote host.
bp_fast_load_gff.pl
This will incrementally load a database. On UNIX systems, it will activate a fast loader that makes the speed almost the same as the bulk loader. Be careful, though, because this software relies on features that are unevenly implemented across platforms. For example, it does not work correctly on Mac OSX.

You will find these scripts in the BioPerl distribution, in the subdirectory scripts/Bio-DB-GFF. If you requested that BioPerl scripts be installed during installation, they will also be found in your command path.

For testing purposes, this distribution includes a GFF file with yeast genome annotations. The file can be found in the test_data subdirectory. If the load is successful, you should see a message indicating that 13298 features were successfully loaded.

Provided that the yeast load was successful, you may now run make test. This invokes a small test script that tests that the database is accessible by the "nobody" user and that the basic feature retrieval functions are working.

You may also wish to load the yeast DNA, so that you can test the three-frame translation and GC content features of the browser. Because of its size, the file containing the complete yeast genome is distributed separately and can be downloaded from:

http://prdownloads.sourceforge.net/gmod/yeast.fasta.gz?download

Load the file with this command:

  bp_load_gff.pl -d yeast -fasta yeast.fasta.gz

You should now be able to browse the yeast genome. Type the following URL into your favorite browser:

http://name.of.your.host/cgi-bin/gbrowse/yeast

This will display the genome browser instructions and a search field. Type in "III" to start searching chromosome III, or search for "glucose" to find a bunch of genes that are involved in glucose metabolism.

IF YOU GET AN ERROR examine the Apache server error log (depending on how Apache was installed, it may be located in /usr/local/apache/logs/, /var/log/httpd/, /var/log/apache, or elsewhere). Usually there will be an informative error message in the error log. The most common problem is MySQL password or permissions problems.


Bio::DB::Das::Chado

This page or section needs to be edited. Please help by editing this page to add your revisions or additions.

Scott needs to fill this in.

Synopsis

 db_adaptor    = Bio::DB::Das::Chado
 db_args       = -dsn dbi:Pg:dbname=chado
                 -user scott
                 -srcfeatureslice 1
                 -organism yeast
                 -version 1
                 -inferCDS 1

Performance

In order to achieve the best possible performance when using this adaptor, please read PostgreSQL Performance Tips.

Documentation
Developers