Difference between revisions of "Talk:GBrowse/Configure HOWTO"
From GMOD
(New page: == Generating this document == From the linux shell I stared up CPAN, then: install Pod::Simple::Wiki::Mediawiki That went smoothly, allowing me to run this... "perl/bin/pod2wiki -s m...) |
(→Loading the GFF file into the database: new section) |
||
| Line 13: | Line 13: | ||
--[[User:DanBolser|DanBolser]] 16:54, 31 October 2008 (UTC) | --[[User:DanBolser|DanBolser]] 16:54, 31 October 2008 (UTC) | ||
| + | |||
| + | == Loading the GFF file into the database == | ||
| + | |||
| + | What to do if this step goes wrong? I keep getting | ||
| + | |||
| + | my.gff: 0 records loaded | ||
| + | |||
| + | |||
| + | With no other output... where is the log? How can I begin to debug? What should I report? Anything at all would be better than 'fail!'. Here is a snippet of the file I am trying to load: | ||
| + | |||
| + | S.lycopersicum-chr4 BLASTX similarity 10343878 10343949 100.00 + . Target 017-11 12064 11993 | ||
| + | S.lycopersicum-chr4 BLASTX similarity 6340794 6340819 100.00 + . Target 017-11 35822 35847 | ||
| + | S.lycopersicum-chr4 BLASTX similarity 16586415 16586438 100.00 + . Target 017-11 35824 35847 | ||
| + | S.lycopersicum-chr4 BLASTX similarity 8030519 8030541 100.00 + . Target 017-11 36541 36563 | ||
| + | S.lycopersicum-chr4 BLASTX similarity 11400019 11400040 100.00 + . Target 017-11 2436 2415 | ||
| + | |||
| + | |||
| + | This is after I apparently sucessfully loaded a fasta file that looks like this: | ||
| + | |||
| + | >S.lycopersicum-chr4 generated_from_agp_file:chr04.v11.agp | ||
| + | GATCAAGGATGGATTCGCGGAGGGCAAAGACCTTGTTGTGTCTGTCATGTCTGCCATGGG | ||
| + | AGAGGAACAGATTAATGCACTGAAGGATATTGGTCCTAAGTAAACGGAGAGAAGGGACAT | ||
| + | GACGGTACCAGCTTGTTCAAGAACATCTACTTCTACTTCGTGTTCTTGAGTTAGATTGTT | ||
| + | GTTCTAATATTTGTTGGAATTTATCTGATTACTTTGAACGTTTTCAAATCTCCTTGTTCG | ||
| + | ATGAGTTTAGTGGGTCATTTGCTAGAGTATATTAGAAGTAATAATTCATTAACTTTCTGT | ||
| + | |||
| + | |||
| + | Any clues? --[[User:DanBolser|DanBolser]] 17:34, 31 October 2008 (UTC) | ||
Latest revision as of 17:34, 31 October 2008
Generating this document
From the linux shell I stared up CPAN, then:
install Pod::Simple::Wiki::Mediawiki
That went smoothly, allowing me to run this...
"perl/bin/pod2wiki -s mediawiki CONFIGURE_HOWTO.pod"
I then stuck the resulting text into the wiki at what seemed like an appropriate location.
--DanBolser 16:54, 31 October 2008 (UTC)
Loading the GFF file into the database
What to do if this step goes wrong? I keep getting
my.gff: 0 records loaded
With no other output... where is the log? How can I begin to debug? What should I report? Anything at all would be better than 'fail!'. Here is a snippet of the file I am trying to load:
S.lycopersicum-chr4 BLASTX similarity 10343878 10343949 100.00 + . Target 017-11 12064 11993 S.lycopersicum-chr4 BLASTX similarity 6340794 6340819 100.00 + . Target 017-11 35822 35847 S.lycopersicum-chr4 BLASTX similarity 16586415 16586438 100.00 + . Target 017-11 35824 35847 S.lycopersicum-chr4 BLASTX similarity 8030519 8030541 100.00 + . Target 017-11 36541 36563 S.lycopersicum-chr4 BLASTX similarity 11400019 11400040 100.00 + . Target 017-11 2436 2415
This is after I apparently sucessfully loaded a fasta file that looks like this:
>S.lycopersicum-chr4 generated_from_agp_file:chr04.v11.agp GATCAAGGATGGATTCGCGGAGGGCAAAGACCTTGTTGTGTCTGTCATGTCTGCCATGGG AGAGGAACAGATTAATGCACTGAAGGATATTGGTCCTAAGTAAACGGAGAGAAGGGACAT GACGGTACCAGCTTGTTCAAGAACATCTACTTCTACTTCGTGTTCTTGAGTTAGATTGTT GTTCTAATATTTGTTGGAATTTATCTGATTACTTTGAACGTTTTCAAATCTCCTTGTTCG ATGAGTTTAGTGGGTCATTTGCTAGAGTATATTAGAAGTAATAATTCATTAACTTTCTGT
Any clues? --DanBolser 17:34, 31 October 2008 (UTC)
