Difference between revisions of "GMOD Middleware"
m (New page: ==Middleware for Chado databases== ===Ongoing Documentation=== This page has been temporarily created by the GMOD developers for the purposes of discussing [http://www.gmod.org Chado] an...) |
(→GBrowse (DasI) Adaptor) |
||
Line 1,147: | Line 1,147: | ||
====Presentation by Scott Cain==== | ====Presentation by Scott Cain==== | ||
+ | |||
+ | |||
+ | =====Create the database===== | ||
+ | |||
+ | $ perl Makefile.PL | ||
+ | $ make | ||
+ | $ sudo make install | ||
+ | $ make load_schema | ||
+ | $ make prepdb # now with Xenopus! | ||
+ | $ make ontologies # load rel, SO, featureprop | ||
+ | |||
+ | =====Loading Data===== | ||
+ | |||
+ | Create some GFF from the specifications: | ||
+ | |||
+ | fake_chromosome example chromosome 1 15017 . . . ID=fake_chromosome; | ||
+ | Name=fake_chromosome | ||
+ | fake_chromosome example gene 13691 14720 . + . ID=xfile;Name=xfile; | ||
+ | Alias=mulder,scully; | ||
+ | Note=A test gene for GMOD meeting | ||
+ | fake_chromosome example mRNA 13691 14720 . + . ID=xfile_mRNA; | ||
+ | Parent=xfile | ||
+ | fake_chromosome example exon 13691 13767 . + . Parent=xfile_mRNA | ||
+ | fake_chromosome example exon 14687 14720 . + . Parent=xfile_mRNA | ||
+ | fake_chromosome example gene 12648 13136 . + . ID=x-men | ||
+ | |||
+ | And load it with the bulk loader: | ||
+ | |||
+ | <code>$ gmod_bulk_load_gff3.pl -g sample.gff</code> | ||
+ | |||
+ | ...lots of output... | ||
+ | |||
+ | For kicks, set up GBrowse. | ||
+ | |||
+ | =====Adaptor components===== | ||
+ | |||
+ | * Bio::DB::Das::Chado | ||
+ | ** Database connection object | ||
+ | * Bio::DB::Das::Chado::Segment | ||
+ | ** Object for any range of DNA | ||
+ | * Bio::DB::Das::Chado::Segment::Feature | ||
+ | |||
+ | =====Use Bio::DB::Das::Chado===== | ||
+ | |||
+ | <perl> | ||
+ | use Bio::DB::Das::Chado; | ||
+ | |||
+ | my $chado = Bio::DB::Das::Chado->new( | ||
+ | -dsn => "dbi:Pg:dbname=test", | ||
+ | -user=> "scott", | ||
+ | -pass=> "" ) || die "no new chado"; | ||
+ | |||
+ | my $gene_name = 'xfile'; | ||
+ | |||
+ | my ($gene_fo) = $chado->get_features_by_name($gene_name); | ||
+ | </perl> | ||
+ | |||
+ | =====Use Some Accessors===== | ||
+ | |||
+ | <perl> | ||
+ | print "symbol: " .$gene_fo->display_name."\n"; | ||
+ | print "synonyms: " .join(', ',$gene_fo->synonyms)."\n"; | ||
+ | print "description: " .$gene_fo->notes."\n"; | ||
+ | print "type: " .$gene_fo->type."\n"; | ||
+ | |||
+ | my ($mRNA) = $gene_fo->sub_SeqFeature(); | ||
+ | my @exons = $mRNA->sub_SeqFeature(); | ||
+ | |||
+ | for my $exon (@exons) { | ||
+ | next unless ($exon->type->method eq 'exon'); | ||
+ | $exon_count++; | ||
+ | print "exon$exon_count start: ".$exon->start."\n"; | ||
+ | print "exon$exon_count end: " .$exon->end. "\n"; | ||
+ | $cds_seq .= $exon->seq->seq; #the first seq | ||
+ | } #returns a Bio::Seq object | ||
+ | </perl> | ||
+ | |||
+ | =====Bulk Output===== | ||
+ | |||
+ | <perl> | ||
+ | my $gene_name = 'x-*'; | ||
+ | |||
+ | my @genes = $chado->get_features_by_name( | ||
+ | -name => $gene_name, | ||
+ | -class=> 'gene' ); | ||
+ | |||
+ | |||
+ | for my $gene (@genes) { | ||
+ | print join("\t", | ||
+ | $gene->feature_id, | ||
+ | $gene->display_name, | ||
+ | $gene->organism),"\n"; | ||
+ | } | ||
+ | </perl> | ||
+ | |||
+ | =====Advantages===== | ||
+ | |||
+ | * Comes 'for free' with GBrowse | ||
+ | * Uses 'familiar' BioPerl idioms, very similar to widely used Bio::DB::GFF (though with fewer methods) | ||
+ | |||
+ | =====Limitations===== | ||
+ | |||
+ | * No ability to write | ||
+ | * Incomplete implementation of Bio::DasI; just enough to make GBrowse work | ||
+ | * As an aside: found two bugs while working on this presentation (now fixed in cvs). | ||
+ | * Also, despite the name, has never been tested with a das server. | ||
+ | |||
+ | =====Conclusion===== | ||
+ | |||
+ | * Not suitable as a 'general' middleware layer | ||
+ | * However, it may be suitable for some applications, particularly if they are somehow similar to GBrowse or other uses of Bio::DB::GFF | ||
===iBatis=== | ===iBatis=== |
Revision as of 16:26, 23 January 2007
Contents
- 1 Middleware for Chado databases
- 1.1 Ongoing Documentation
- 1.2 Middleware Evaluation January 2007
- 1.3 Introduction
- 1.4 Object-Relational Mapping Principles
- 1.5 XORT
- 1.5.1 Background
- 1.5.2 Technical Overview
- 1.5.3 Special topics
- 1.5.4 Limitations
- 1.5.5 Presentation by Pinglei Zhou and Josh Goodman
- 1.5.5.1 Generic Modern Language Database?
- 1.5.5.2 Introduction
- 1.5.5.3 Components
- 1.5.5.4 Highlights of Chado XML Specification
- 1.5.5.5 Putting it together: New FlyBase dataflow Part 1
- 1.5.5.6 Putting it together: New FlyBase dataflow Part 2
- 1.5.5.7 Data & Report Generation
- 1.5.5.8 Hibernate & XORT
- 1.5.5.9 Support for complex transactions using XORT
- 1.5.5.10 CHIA (Chado Interface Application)
- 1.5.5.11 Limitations
- 1.5.5.12 Documentation
- 1.5.5.13 Acknowledgements
- 1.6 Chado::AutoDBI
- 1.6.1 Background
- 1.6.2 Technical Overview
- 1.6.3 Special topics
- 1.6.4 Limitations
- 1.6.5 Presentation by Brian O'Connor
- 1.6.5.1 Project Overview
- 1.6.5.2 Technical Overview
- 1.6.5.3 Project Overview
- 1.6.5.4 Technical Overview
- 1.6.5.5 Technical Overview
- 1.6.5.6 Technical Overview
- 1.6.5.7 Technical Overview
- 1.6.5.8 Technical Overview
- 1.6.5.9 Technical Overview
- 1.6.5.10 Problem 1
- 1.6.5.11 Problem 2
- 1.6.5.12 Problems 3, 4, & 5
- 1.6.5.13 Special Topics
- 1.6.5.14 Limitations
- 1.6.5.15 For More Information
- 1.7 Modware
- 1.7.1 Background
- 1.7.2 Technical Overview
- 1.7.3 Special topics
- 1.7.4 Limitations
- 1.7.5 Presentation by Eric Just
- 1.7.5.1 Why Modware Was Developed
- 1.7.5.2 What is in the Feature Table?
- 1.7.5.3 Modware Features
- 1.7.5.4 Architectural Overview
- 1.7.5.5 Create and Insert Chromosome
- 1.7.5.6 Create and Insert a Gene
- 1.7.5.7 Create and Insert a Gene
- 1.7.5.8 Create and Insert a Gene
- 1.7.5.9 Create and Insert a Gene
- 1.7.5.10 Create mRNA BioPerl Object
- 1.7.5.11 Create and Insert mRNA
- 1.7.5.12 Writing the Report
- 1.7.6 Writing the Report
- 1.8 GBrowse (DasI) Adaptor
- 1.9 iBatis
- 1.10 Hibernate
- 1.11 PSU Chado Interface
- 1.12 Notes
Middleware for Chado databases
Ongoing Documentation
This page has been temporarily created by the GMOD developers for the purposes of discussing Chado and middleware for Chado. It will be moved to a permanent location shortly.
Middleware Evaluation January 2007
A group of some 50 GMOD developers met at the annual meeting to discuss middleware. This one day meeting had the following general goals:
- To educate GMOD programmers on methods and practices for Middleware
- To facilitate discussion on the best methods
- To guide GMOD to a uniform Middleware layer
- To generate this central reference document for Middleware projects,
- Platform information
- Strengths & weaknesses of different Middleware packages
Introduction
One of the key characteristics of the GMOD software project is the variety of approaches and components that it supports. This applies to applications, database schemas, as well as to middleware, a software layer that mediates the exchange of data between the applications and the databases. Despite this diversity certain applications and schemas have emerged as key supported components in GMOD, such as the GBrowse application and the Chado schema, to name just two. However, a consensus view has not emerged with respect to middleware, and there are certainly a number of different middleware packages that have been used in the GMOD world, coming from within this world and from the larger world of open source.
In late 2006 the GMOD developers took note of the large number of middleware packages in use and elected to embark on a short-term study to evaluate and compare these packages. The primary motivation here was to select or recommend certain packages over others specifically within the GMOD context. The assumption is that making such recommendations will serve to focus the developers' effort on a smaller number of packages. Clearly it's also assumed that such a focus will inevitably lead to greater support for and use of those recommended packages, and that all will GMOD will benefit.
Another purpose of this study is to educate GMOD programmers on best practices concerning the use and development of middleware. It's expected that common agreement on these practices will lead to the development of more effective software as well as the best use of the software in practice. Finally, this study should generate a central reference document on these different middleware packages used in GMOD. This reference will contain platform- and language-specific information as well as descriptions of the strengths and weaknesses of the packages that can be used by GMOD developers when considering middleware.
General Evaluation Criteria
The GMOD developers proposed that each presenter provide some basic information about each middleware package, both general and technical. In addition each middleware application was asked to address a set of sample problems, shown below. These example problems are thought to typify some of the common functions that the scientist may need when working with their own database. It was understood that not all software would be able to handle all aspects of the sample problems and this demonstration was not intended to be live.
Problem 1
Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id
for each inserted gene.
Note:
- The coordinates are given in exact coordinates.
- Use the
organism_id
for your organism - Store description in the chado table
featureprop
- A sequence in fasta format (see Fake Chromosome) should be loaded as genomic sequence, either chromosome or contig -- this will be used as a
srcfeature
infeatureloc
Gene descriptions:
symbol: xfile synonyms: mulder, scully description: A test gene for GMOD meeting mRNA Feature exon_1: start: 13691 end: 13767 strand: 1 srcFeature_id: Id of genomic sample exon_2: start: 14687 end: 14720 strand: 1 srcFeature_id: Id of genomic sample symbol: x-men synonyms: wolverine mRNA Feature exon_1: start: 12648 end: 13136 strand: 1 srcFeature_id: Id of genomic sample symbol: x-ray synonyms: none exon: start: 1703 end: 1900 strand: 1 srcFeature_id: Id of genomic sample
Problem 2
Retrieve and print the following report for gene xfile (the coding sequence and exon coordinates are derived from the associated mRNA feature). The results should resemble the following:
symbol: xfile synonyms: mulder, scully description: A test gene for GMOD meeting type: gene exon1 start: 13691 exon1 end: 13767 exon2 start: 14687 exon2 end: 14720 >xfile cds ATGGCGTTAGTATTCATGGTTACTGGTTTCGCTACTGATATCACCCAGCGTGTAGGCTGT GGAATCGAACACTGGTATTGTATAAATGTTTGTGAATACACTGAGAAATAA
Problem 3
Update the gene xfile: change the name symbol to x-file and retrieve the changed record. Regenerate the report from Problem 1. The results should resemble the following:
symbol: x-file synonyms: mulder, scully description: A test gene for GMOD meeting type: gene exon1 start: 13691 exon1 end: 13767 exon2 start: 14687 exon2 end: 14720 >x-file cds ATGGCGTTAGTATTCATGGTTACTGGTTTCGCTACTGATATCACCCAGCGTGTAGGCTGT GGAATCGAACACTGGTATTGTATAAATGTTTGTGAATACACTGAGAAATAA
Problem 4
Search for all genes with symbols starting with x-. With the results produce the following simple result list (organism will vary):
1323 x-file Xenopus laevis 1324 x-men Xenopus laevis 1325 x-ray Xenopus laevis
Problem 5
Delete the gene x-ray using the geneId
. Run the search and report in Problem 4 again to show the delete has taken
place, with a result resembling the following:
1323 x-file Xenopus laevis 1324 x-men Xenopus laevis
Object-Relational Mapping Principles
Presentation by Sohel Merchant
Sohel Merchant, Bioinformatics Software Engineer at dictyBase, Center for Genetic Medicine, Northwestern University, Chicago. This is an edited version of Sohel's presentation.
Outline
- The Problem
- Solutions
- ORM
- Perl – Class::DBI
- Summary
The Problem
- Developers need to perform Create, Retrieve, Update, Delete (aka CRUD) operations on data inside an application.
- The real world objects represented using a programming language needs to be stored in databases
- Using relational databases to store object-oriented data leads to a semantic gap
- RDBMS have fixed types, but OO can have more complicated user defined types.
Solutions
- Data Access Object (DAO)
- Developer writes a class which contains one attribute for each field in the table
- Methods for CRUD typically contains JDBC/DBI code with the necessary SQL statements.
- Object Relational Mapping (ORM), WikiPedia:
- “ORM is a programming technique that links databases to object-oriented language concepts, creating (in effect) a virtual object database.“
- Developer needs to configure the ORM
- Less amount of manual coding
- CRUD methods are automatically generated by the ORM layer
ORM
ORM solutions
- Perl
- Class::DBI
- Java
- EJB
- Hibernate
- JDO
- iBatis
Perl - Class::DBI
- Provides a simple interfaces for wrapping Perl classes around a database tables
- Tables are mapped directly to objects
- The table column name are mapped to the get/set methods
- Can be used with transactions
Class::DBI
Defining a class in Class::DBI to represent a table:
CVTERM cvterm_id cv_id name definition dbxref_id
Corresponding code:
<perl> package Chado::Cvterm; use base 'Chado::DBI'; Chado::Cvterm->set_up_table('Cvterm'); </perl>
Class::DBI - CRUD
<perl>
- Create
$term_dbobj = Chado::Cvterm->create({
name => ”DUMMY TERM”, cv_id => 1, dbxref_id => 125 });
- Retrieve
$term_dbobj = Chado::Cvterm->retrieve(2);
- Update
$term_dbobj->name( $term->name() ); $term_dbobj->definition( $term->definition );
- Delete
$term_dbobj->delete(); </perl>
Java - Hibernate
- Hibernate maps Java Objects directly to database tables
- Scalable
- Works well for controlled Data model
Java - iBatis
- iBATIS maps Java Objects to the results of SQL Queries
- XML definitions for queries
- Queries and managing Maps
- Transactions
- Good fit for existing database schema
Summary
- ORM provides painless roundtrip of data between the application and database.
- Reduces the amount of SQL code and allows a programmatic style interface to the RDBMS
- Choice of ORM solution depends on the type of project
XORT
Background
- Source: http://sourceforge.net/project/showfiles.php?group_id=27707
- Language: Perl
- Authors: Pinglei Zhou
- Users:
- Support:
- Third party code:
Technical Overview
- Database connectivity:
- Transaction support:
- Code generation:
Special topics
Additional demonstrations of what your software does well.
Limitations
Presentation by Pinglei Zhou and Josh Goodman
Generic Modern Language Database?
We speak many languages with different people, for example:
- My Parents: hometown dialect
- My wife: Mandarin (official form of Chinese)
- My son: Plain English
- My colleagues: ‘chadoXML’
ChadoXML is the common language in the FlyBase and Chado world.
Introduction
- An XML-database mapping system for data exchange between DB and XML-driven application
- Developed/Supported by Pinglei Zhou at FlyBase Harvard, 0.007 version now.
- Used: All FlyBase sites
- Written in Perl
- Required perl modules:
- XML::Parser::PerlSAX
- Unicode::String
- XML::DOM
- DBI
Components
- Database & Schema
- ChadoXML Specification
- DumpSpec collections
- Tools
Highlights of Chado XML Specification
- Unique represent of specific database schema
- Get away with those internal primary key value
- Static vs. Operational
- Encoding for non-ASCII characters
- Macro mechanism (object reference)
Putting it together: New FlyBase dataflow Part 1
1.a. Proforma (FlyBase Cambridge) is converted to ChadoXML
1.b. ChadoXML is created by Apollo (Harvard)
1.c. ChadoXML is created by Java SEAN (Harvard)
2. All ChadoXML is loaded into Chado by XORT
Putting it together: New FlyBase dataflow Part 2
3. Chado (Harvard) is denormalized and loaded into Chado (Indiana)
4. ChadoXML is created from Chado using XORT
5.a. GFF and Fasta is created from ChadoXML
5.b. HTML is created from Chado XML
Data & Report Generation
- Content of all output files is controlled by XML dumpspecs.
- Dumpspecs are language independent.
- Easily readable (with knowledge of Chado structure).
- All XML transformation steps are done with XSLT v2.
- Saxon XSLT (http://saxon.sourceforge.net/)
- ChadoXML is split into individual chunks before XSLT processing to accommodate large file sizes.
- Extremely fast. We can process all data for ~60,000 Drosophila genes in under 30 minutes.
Hibernate & XORT
- Hibernate didn't scale well when dealing with 5,000+ features in bulk.
- The test was simply calling
print()
statements
- The test was simply calling
- Performance tweaks for Hibernate can be quite complicated to setup for bulk operations.
- XORT is currently handling ~6 million features in production with only minor performance problems.
- XORT is much more language independent.
Support for complex transactions using XORT
For example:
- Find all records linked to a record using dumpspec
- Merge gene x into y, each with thousands of records attached
Step 1. Dump all data use simple dumpspec
<chado> <feature dump=“all”> <uniquename test=“eq”>x</uniquename> </feature> </chado>
Step 2 Delete feature x from DB, with triggers to clean orphan records, if necessary
Step 3. Edit the output xml, change uniquename x to y, then load the edited file back to DB
CHIA (Chado Interface Application)
A Java application that organizes SQL and XORT functionality for internal users, e.g.:
- Dump chado-XML for gene regions for Apollo curation
- Organize and execute “canned” SQL queries
- Serve IDs for curators (in development)
- Dynamic browser Chado without writing SQL statement
CHIA is being designed to be extensible for adding new functionality as needed.
Limitations
- DB Schema follow certain rules
- All have internal int primary key
- All have unique key(s)
- It may take long path to retrieve certain type of data
- Example: gene->allele->genotype->phenotype via feature_relationship
- Structure not store in memory, you flush out data as it goes
Documentation
- Using Chado to Store Genome Annotation Data
- Current Protocols in Bioinformatics (Baxevanis, A.D., and Davison, D.B., eds) 2, 9.6.1-9.6.28.
- XORT specification docs
- XORT draft (unpublished)
- GMOD case demo procedure
- All in the doc directory of XORT package, http://www.gmod.org
Acknowledgements
- Willian Gelbart
- Chris Mungall
- David Emmert
- Mark Gibson
- Stan Letovsky
- Nomi Harris
- Frank Smutniak
- Suzanna Lewis
- Peili Zhang
- Stan Letovsky
- Haiyan Zhang
- Aubrey de Grey
- Andy Schroeder
- Don Gilbert
- Susan Russo
- Mark Zythovicz
- Scott Cain
- Lincoln Stein
- Victor Strelets
- Robert Wilson
- Paul Leyland
Chado::AutoDBI
Background
- Source: http://sourceforge.net/projects/gmod/
- Language: Perl
- Authors: Brian O'Connor
- Users:
- Support:
- Third party code:
Technical Overview
- Database connectivity:
- Transaction support:
- Code generation:
Special topics
- Demonstrations of what your software does well
Limitations
Presentation by Brian O'Connor
Project Overview
- Who wrote/supports it?
- Chado::AutoDBI: Allen Day, Scott Cain, Brian O'Connor, & others
- Turnkey: Allen Day, Scott Cain, Brian O'Connor
- Third party code used?
- Based on Class::DBI: Michael Schwern & Tony Bowden
Technical Overview
- Code Generation
Project Overview
Convert SQL Queries/Inserts/Deletes -> Object Calls
INSERT INTO feature (organism_id, name) VALUES (1, 'foo');
To:
<perl>
my $feature = Turnkey::Model::Feature->find_or_create({ organism_id => $organism, name => 'xfile', uniquename => 'xfile', type_id => $mrna_cvterm, is_analysis => 'f', is_obsolete => 'f' });
</perl>
Technical Overview
- Database Connection: use a base class
<perl> use base qw(Class::DBI::Pg);
my ($dsn, $name, $pass); $dsn = "dbi:Pg:host=localhost;dbname=chado;port=5432"; $name = "postgres"; $pass = "";
Turnkey::Model::DBI->set_db('Main', $dsn, $name, $pass, {AutoCommit => 1}); </perl>
Technical Overview
- Basic ORM Object: Feature
<perl> package Turnkey::Model::Feature; use base 'Turnkey::Model::DBI';
Turnkey::Model::Feature->set_up_table('feature');
- Primary key accessors
sub id { shift->feature_id } sub feature { shift->feature_id } </perl>
- data field accessors by Class::Accessor
Technical Overview
- Basic ORM Object: Feature
- has_a
<perl>
- has_a
Turnkey::Model::Feature->has_a( type_id => "Turnkey::Model::Cvterm" ); sub cvterm { return shift->type_id; } </perl>
- Basic ORM Object: Feature
- has_many
<perl>
- has_many
Turnkey::Model::Feature->has_many('feature_synonym_feature_id',
'Turnkey::Model::Feature_Synonym' => 'feature_id');
sub feature_synonyms { return shift->feature_synonym_feature_id; }
Turnkey::Model::Feature->has_many('featureprop_feature_id',
'Turnkey::Model::Featureprop' => 'feature_id');
sub featureprops { return shift->featureprop_feature_id; } </perl>
Technical Overview
- Basic ORM Object: Feature
- skipping linker tables for has_many
<perl>
- skip over feature_synonym table
- method 1
sub synonyms { my $self = shift; return map $_->synonym_id, $self->feature_synonyms; }
- method 2
Turnkey::Model::Feature->has_many( synonyms2 =>
['Turnkey::Model::Feature_Synonym' => 'synonym_id']);
</perl>
Technical Overview
- Transactions
<perl>
sub do_transaction { my $class = shift; my ( $code ) = @_; # Turn off AutoCommit for this scope. # A commit will occur at the exit of this block automatically, # when the local AutoCommit goes out of scope. local $class->db_Main->{ AutoCommit };
# Execute the required code inside the transaction. eval { $code->() }; if ( $@ ) { my $commit_error = $@; eval { $class->dbi_rollback }; # might also die! die $commit_error; } }
</perl>
Technical Overview
- Lazy Loading
<perl> Turnkey::Model::Feature->columns( Primary => qw/feature_id/ ); Turnkey::Model::Feature->columns( Essential => qw/name organism_id type_id/ ); Turnkey::Model::Feature->columns( Others => qw/residues .../ ); </perl>
Typically:
<perl> Turnkey::Model::Feature->set_up_table('feature'); </perl>
Problem 1
- Create Feature & Add Description
<perl>
- now create mRNA feature
my $feature = Turnkey::Model::Feature->find_or_create({
organism_id => $organism, name => 'xfile', uniquename => 'xfile', type_id => $mrna_cvterm, is_analysis => 'f', is_obsolete => 'f' });
- create description
my $featureprop = Turnkey::Model::Featureprop->find_or_create({
value => 'A test gene for GMOD meeting', feature_id => $feature, type_id => $note_cvterm, });
</perl>
Problem 2
- Retrieve a Feature via Searching
<perl>
- objects for global use
- the organism for our new feature
my $organism = Turnkey::Model::Organism->search(abbreviation => "S.cerevisiae")->next;
- the cvterm for a "Note"
my $note_cvterm = Turnkey::Model::Cvterm->retrieve(2);
- searching name by wildcard
my @results = Turnkey::Model::Feature->search_like(name => 'x-%'); </perl>
Problems 3, 4, & 5
- Update a Feature
<perl>
# update the xfile gene name $feature->name("x-file"); $feature->update();
</perl>
- Delete a Feature
<perl>
- now delete the x-file feature
$feature->delete(); </perl>
Special Topics
- Things Chado::AutoDBI does well
- easy to use
- easy to port
- other DBs
- other platforms
- autogenerated via Turnkey
- find_or_create
Limitations
- performance
- joins & complex queries
<perl>
- Add the add_constructor for looking for name lengths
__PACKAGE__ ->add_constructor(long_names => qq{ length(name) > 15 });
- Custom SQL
__PACKAGE__->set_sql(xfiles => qq{
SELECT FEATURE_ID FROM FEATURE WHERE NAME = 'xfiles' });
</perl>
For More Information
- Class::DBI
- Turnkey
- Biopackages
Modware
Background
- Source: http://gmod-ware.sourceforge.net
- Language: Perl
- Authors: Sohel Merchant, Eric Just
- Users:
- Support:
- Third party code:
Technical Overview
- Database connectivity:
- Transaction support:
- Code generation:
Special topics
- Demonstrations of what your software does well
Limitations
Presentation by Eric Just
Eric Just, Senior Bioinformatics Scientist, dictyBase: http://dictybase.org Center for Genetic Medicine, Northwestern University. This is an edited version of Eric's presentation.
Why Modware Was Developed
- Each feature type requires different behavior
- Want to leave schema semantics out of application
- Want to leverage work done in BioPerl
- Re-use code developed for common use cases
What is in the Feature Table?
The core of Chado
- Chromosome
- Contig
- Gene
- mRNA
- Exon
- Lots of other things - See Sequence Ontology!
Modware Features
- Multiple Feature classes
- CHROMOSOME, GENE, MRNA, CONTIG
- Each class provides type specific methods
- Logic such as building exon structure of mRNA features is encapsulated
- Parent class Modware::Feature
- Provides common methods
- Abstract factory for various feature types
Architectural Overview
- Object-oriented Perl interface to Chado
- Built on top of Chado::AutoDBI
- Connection handled by GMOD
- Database transactions supported
- BioPerl used to represent and manipulate sequence and feature structure
- ‘Lazy’ evaluation
Create and Insert Chromosome
<perl>
my $seq_io = new Bio::SeqIO( -file => "../data/fake_chromosome.txt", -format => 'fasta' );
# Bio::SeqIO will return a Bio::Seq object which # Modware uses as its representation my $seq = $seq_io->next_seq();
my $reference_feature = new Modware::Feature( -type => 'chromosome', -bioperl => $seq, -description => "This is a test", -name => 'Fake', -source => 'GMOD 2007 Demo' );
# Inserts chromosome into database $reference_feature->insert();
</perl>
Create and Insert a Gene
1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.
Gene Feature symbol: x-ray synonyms: none mRNA Feature exon: start: 1703 end: 1900 strand: 1 srcFeature_id: Id of genomic sample
Create and Insert a Gene
1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.
Gene Feature symbol: x-men synonyms: wolverine mRNA Feature exon_1: start: 12648 end: 13136 strand: 1 srcFeature_id: Id of genomic sample
Create and Insert a Gene
1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.
Gene Feature symbol: xfile synonyms: mulder, scully description: A test gene for GMOD meeting mRNA Feature exon_1: start: 13691 end: 13767 strand: 1 srcFeature_id: Id of genomic sample exon_2: start: 14687 end: 14720 strand: 1 srcFeature_id: Id of genomic sample
Create and Insert a Gene
symbol: xfile synonyms: mulder, scully description: A test gene for GMOD meeting …
<perl> my $gene_feature = new Modware::Feature(
-type => 'gene', -name => 'xfile', -description => 'A test gene for GMOD meeting', -source => 'GMOD 2007 Demo‘
);
$gene_feature->add_synonym( 'mulder' ); $gene_feature->add_synonym( 'scully' );
- inserts object into database
$gene_feature->insert(); print 'Inserted gene with feature_id:'.$gene_feature->feature_id()."\n"; </perl>
Create mRNA BioPerl Object
exon_1: exon_2: start: 13691 start: 14687 end: 13767 end: 14720 strand: 1 strand: 1 srcFeature_id: Id of genomic sample srcFeature_id: Id of genomic sample
<perl>
- First, create exon features (using Bioperl)
my $exon_1 = new Bio::SeqFeature::Gene::Exon (
-start => 13691, -end => 13767, -strand => 1, -is_coding => 1
);
my $exon_2 = new Bio::SeqFeature::Gene::Exon (
-start => 14687, -end => 14720, -strand => 1, -is_coding => 1
);
- Next, create transcript feature to 'hold' exons (using Bioperl)
my $bioperl_mrna = new Bio::SeqFeature::Gene::Transcript();
- Add exons to transcript (using Bioperl)
$bioperl_mrna->add_exon( $exon_1 ); $bioperl_mrna->add_exon( $exon_2 );
</perl>
Create and Insert mRNA
The BioPerl object holds the location information, but now we want to create a Modware object and link it to the gene as well as locate it on the chromosome.
<perl>
# Now create Modware Feature to 'hold' bioperl object my $mrna_feature = new Modware::Feature( -type => 'mRNA', -bioperl => $bioperl_mrna, -source => 'GMOD 2007 Demo', -reference_feature => $reference_feature );
# Associate mRNA to gene (required for insertion) $mrna_feature->gene( $gene_feature );
# inserts object into database $mrna_feature->insert();
</perl>
Writing the Report
2) Retrieve and print the following report for gene xfile
symbol: xfile synonyms: mulder, scully description: A test gene for GMOD meeting type: gene exon1 start: 13691 exon1 end: 13767 exon2 start: 14687 exon2 end: 14720 >xfile cds ATGGCGTTAGTATTCATGGTTACTGGTTTCGCTACTGATATCACCCAGCGTGTAGGCTGT GGAATCGAACACTGGTATTGTATAAATGTTTGTGAATACACTGAGAAATAA
<perl>
use Modware::Gene; use GMODWriter;
my $xfile_gene = new Modware::Gene( -name => 'xfile' ); GMODWriter->Write_gene_report( $xfile_gene );
</perl>
Writing the Report
2) Retrieve and print the following report for gene xfile
<perl> package GMODWriter; sub Write_gene_report { my ($self, $gene) = @_; my $symbol = $gene->name();
my @synonyms = @{ $gene->synonyms() }; my $syn_string = join ",", @synonyms; my $description = $gene->description(); my $type = $gene->type();
- get features associated with the gene that are of type 'mRNA'
my ($mrna) = grep { $_->type() eq 'mRNA' } @{ $gene->features() };
- use bioperl method to get exons from mRNA
my @exons = $mrna->bioperl->exons_ordered();
- Modware will return a nice fasta file for you.
my $fasta = $mrna->sequence( -type => 'cds', -format => 'fasta' );
- Now print the actual report
print "symbol: $symbol\n"; print "synonyms: $syn_string\n"; print "description: $description\n"; print "type: $type\n";
my $count = 0;
foreach my $exon (@exons ) {
$count++; print "exon${count} start: ".$exon->start()."\n";
print "exon${count} end: ".$exon->end()."\n";
} print "$fasta";
}
. . .
Updating a Gene Name
Problem 3) Update the gene xfile: change the name symbol to x-file and retrieve the changed record. Regenerate gene report
<perl>
use Modware::Gene; use Modware::DBH; use GMODWriter;
eval{
# get xfile gene my $xfile_gene = new Modware::Gene( -name => 'xfile' );
# change the name $xfile_gene->name( 'x-file' ); # write changes to database $xfile_gene->update();
# we can use the original object if we want, but instead # we refetch from the database to 'prove' the name has been changed my $xfile_gene2 = new Modware::Gene( -name => 'x-file' ); # use our GMODWriter package to write report for x-file GMODWriter->Write_gene_report( $xfile_gene2 );
}; if ($@){ warn $@; new Modware::DBH->rollback(); }
</perl>
Search and Display Results
Problem 4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list (organism will vary):
1323 x-file Xenopus laevis 1324 x-men Xenopus laevis 1325 x-ray Xenopus laevis
<perl>
use Modware::Gene; use Modware::DBH; use GMODWriter;
# find genes starting with 'x-' my $results = Modware::Search::Gene->Search_by_name( 'x-*' );
# write the search results GMODWriter->Write_search_results( $results )
</perl>
Search and Display Results
Problem 4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list (organism will vary):
1323 x-file Xenopus laevis 1324 x-men Xenopus laevis 1325 x-ray Xenopus laevis
<perl>
sub Write_search_results {
my ($self, $itr) = @_; # loop through iterator while (my $gene = $itr->next) { # print the requested information print $gene->feature_id . "\t" . $gene->name . "\t" . $gene->organism_name . "\n"; }
} </perl>
Delete a Gene
Problem 5) Delete the gene x-ray. Run the search and report again.
1323 x-file Xenopus laevis 1324 x-men Xenopus laevis
<perl>
# get the xray gene my $xray = new Modware::Gene( -name => 'x-ray' );
# set is_deleted = 1, this will 'hide' the gene from Searches $xray->is_deleted(1);
# write change to database $xray->update();
# find genes starting with 'x-' my $results = Modware::Search::Gene->Search_by_name( 'x-*' );
# write the search results GMODWriter->Write_search_results( $results )
</perl>
Other Modware Highlights
- Easy to write applications with Modware
- Extensible
- Available through Sourceforge
** http://gmod-ware.sourceforge.net
- Easy to install
- Large unit test coverage
- Current release 0.2-RC1
- Works with GMOD’s latest release
- Sample script demoed here are available
- sample_scripts directory
Other Nice Things About Modware
- Bioperl-style documentation
Coming Attractions
- Support for changing genomic sequence
- ncRNAs
- UTRs
- Onotology modules
- Phenotype Annotations
- Send us your ideas!
Limitations
- Does not have full flexibility of Chado
- Not enough users to get quality feedback
- Performance (?)
- Language dependent
Acknowlegments
- Rex Chisholm, PhD
- Warren Kibbe, PhD
- Scott Cain
- Brian O’connor
- Sohel Merchant
- Petra Fey
- Pascale Gaudet,
- Karen Pilcher
- BioPerl
- GMOD
- SGD
GBrowse (DasI) Adaptor
Background
- Source: http://sourceforge.net/project/showfiles.php?group_id=27707&package_id=34513&release_id=433523
- Language: Perl
- Authors: Scott Cain
- Users:
- Support:
- Third party code:
Technical Overview
- Database connectivity:
- Transaction support:
- Code generation:
Special topics
- Demonstrations of what your software does well
Limitations
Presentation by Scott Cain
Create the database
$ perl Makefile.PL $ make $ sudo make install $ make load_schema $ make prepdb # now with Xenopus! $ make ontologies # load rel, SO, featureprop
Loading Data
Create some GFF from the specifications:
fake_chromosome example chromosome 1 15017 . . . ID=fake_chromosome; Name=fake_chromosome fake_chromosome example gene 13691 14720 . + . ID=xfile;Name=xfile; Alias=mulder,scully; Note=A test gene for GMOD meeting fake_chromosome example mRNA 13691 14720 . + . ID=xfile_mRNA; Parent=xfile fake_chromosome example exon 13691 13767 . + . Parent=xfile_mRNA fake_chromosome example exon 14687 14720 . + . Parent=xfile_mRNA fake_chromosome example gene 12648 13136 . + . ID=x-men
And load it with the bulk loader:
$ gmod_bulk_load_gff3.pl -g sample.gff
...lots of output...
For kicks, set up GBrowse.
Adaptor components
- Bio::DB::Das::Chado
- Database connection object
- Bio::DB::Das::Chado::Segment
- Object for any range of DNA
- Bio::DB::Das::Chado::Segment::Feature
Use Bio::DB::Das::Chado
<perl> use Bio::DB::Das::Chado;
my $chado = Bio::DB::Das::Chado->new(
-dsn => "dbi:Pg:dbname=test", -user=> "scott", -pass=> "" ) || die "no new chado";
my $gene_name = 'xfile';
my ($gene_fo) = $chado->get_features_by_name($gene_name); </perl>
Use Some Accessors
<perl> print "symbol: " .$gene_fo->display_name."\n"; print "synonyms: " .join(', ',$gene_fo->synonyms)."\n"; print "description: " .$gene_fo->notes."\n"; print "type: " .$gene_fo->type."\n";
my ($mRNA) = $gene_fo->sub_SeqFeature(); my @exons = $mRNA->sub_SeqFeature();
for my $exon (@exons) {
next unless ($exon->type->method eq 'exon'); $exon_count++; print "exon$exon_count start: ".$exon->start."\n"; print "exon$exon_count end: " .$exon->end. "\n"; $cds_seq .= $exon->seq->seq; #the first seq
} #returns a Bio::Seq object </perl>
Bulk Output
<perl>
my $gene_name = 'x-*';
my @genes = $chado->get_features_by_name( -name => $gene_name, -class=> 'gene' );
for my $gene (@genes) { print join("\t", $gene->feature_id, $gene->display_name, $gene->organism),"\n"; }
</perl>
Advantages
- Comes 'for free' with GBrowse
- Uses 'familiar' BioPerl idioms, very similar to widely used Bio::DB::GFF (though with fewer methods)
Limitations
- No ability to write
- Incomplete implementation of Bio::DasI; just enough to make GBrowse work
- As an aside: found two bugs while working on this presentation (now fixed in cvs).
- Also, despite the name, has never been tested with a das server.
Conclusion
- Not suitable as a 'general' middleware layer
- However, it may be suitable for some applications, particularly if they are somehow similar to GBrowse or other uses of Bio::DB::GFF
iBatis
Background
- Source: http://ibatis.apache.org/
- Language: Java
- Authors: Apache group
- Users:
- Support:
- Third party code:
Technical Overview
- Database connectivity:
- Transaction support:
- Code generation:
Special topics
- Demonstrations of what your software does well
Limitations
Presentation by Jeff Bowes
Hibernate
Background
- Source: http://www.hibernate.org
- Language: Java
- Authors: JBoss group
- Users:
- Support:
- Third party code:
Technical Overview
- Database connectivity:
- Transaction support:
- Code generation:
Special topics
- Demonstrations of what your software does well
Limitations
Presentation by Robert Bruggner
PSU Chado Interface
Background
- Source:
- Language: Java
- Authors: Chinmay Patel, Adrian Tivey
- Users:
- Support:
- Third party code:
Technical Overview
- Database connectivity:
- Transaction support:
- Code generation:
Special topics
- Demonstrations of what your software does well