Difference between revisions of "Modware Presentation"

Latest revision as of 21:24, 15 August 2013

Eric Just, Senior Bioinformatics Scientist, dictyBase: http://dictybase.org Center for Genetic Medicine, Northwestern University. This is an edited version of Eric's presentation.

Why Modware Was Developed

• Each feature type requires different behavior
• Want to leave schema semantics out of application
• Want to leverage work done in BioPerl
• Re-use code developed for common use cases
• DictyBase is using a superset of Modware
  • Modware uses this code, but strips out all non-standard GMOD code
• Provides nice interface over stock GMOD installation

What is in the Feature Table?

The core of Chado

• Chromosome
• Contig
• Gene
• mRNA
• Exon
• Lots of other things - See Sequence Ontology!

Modware Features

• Multiple Feature classes
  • CHROMOSOME, GENE, MRNA, CONTIG
• Each class provides type specific methods
• Logic such as building exon structure of mRNA features is encapsulated
• Parent class Modware::Feature
  • Provides common methods such as name(), primary_id(), external_ids()
  • Abstract factory for various feature types
• Lazy : information is only retrieved when you ask for it, but cached for speedy retrieval the next time it is required
• Uses BioPerl and its objects
  • Each different feature subclass has a bioperl() method that returns an appropriate BioPerl object.
  • Bioperl object manipulation used to update feature coordinates
• Subclasses provide type-specific methods
  • For example, Chromosome isn't the same as Gene which isn't the same as ...
• Any feature type not explicitly supported in Modware::Feature class is blessed as a Modware::Feature::GENERIC class
  • Has a start/stop coordinate on a genomic sequence feature (no structure like a transcript with exons)

Architectural Overview

• Object-oriented Perl interface to Chado
• Built on top of Chado::AutoDBI
• Connection handled by GMOD
• Database transactions supported
• BioPerl used to represent and manipulate sequence and feature structure
• ‘Lazy’ evaluation

Create and Insert Chromosome

   my $seq_io = new Bio::SeqIO(
      -file       => "../data/fake_chromosome.txt",
      -format => 'fasta'
   );
 
   # Bio::SeqIO will return a Bio::Seq object which
   # Modware uses as its representation
   my $seq = $seq_io->next_seq();
 
   my $reference_feature = new Modware::Feature(
      -type              => 'chromosome',
      -bioperl          => $seq,
      -description   => "This is a test",
      -name            => 'Fake',
      -source          => 'GMOD 2007 Demo'
   );
 
   # Inserts chromosome into database
   $reference_feature->insert();

Problem 1 - Create and Insert a Gene

1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.

                        Gene Feature
                            symbol: x-ray
                            synonyms: none
                            mRNA Feature
                                exon:
                                    start: 1703
                                    end: 1900
                                    strand: 1
                                    srcFeature_id: Id of genomic sample

Problem 1 - Create and Insert a Gene

1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.

                        Gene Feature
                           symbol: x-men
                           synonyms: wolverine
                           mRNA Feature
                               exon_1:
                                   start: 12648
                                   end: 13136
                                   strand: 1
                                   srcFeature_id:
                                       Id of genomic sample

Problem 1 - Create and Insert a Gene

1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.

                     Gene Feature
                         symbol: xfile
                         synonyms: mulder, scully
                         description: A test gene for GMOD meeting
                         mRNA Feature
                             exon_1:
                                 start: 13691
                                 end: 13767
                                 strand: 1
                                 srcFeature_id: Id of genomic sample
                             exon_2:
                                 start: 14687
                                 end: 14720
                                  strand: 1
                                  srcFeature_id: Id of genomic sample

Problem 1 - Create and Insert a Gene

      symbol: xfile
             synonyms: mulder, scully
             description: A test gene for GMOD meeting
     …

my $gene_feature = new Modware::Feature(
    -type             => 'gene',
    -name           => 'xfile',
    -description  => 'A test gene for GMOD meeting',
    -source         => 'GMOD 2007 Demo'
);
 
$gene_feature->add_synonym( 'mulder' );
$gene_feature->add_synonym( 'scully' );
 
# inserts object into database
$gene_feature->insert();
print 'Inserted gene with feature_id:'.$gene_feature->feature_id()."\n";

Problem 1 - Create mRNA BioPerl Object

          exon_1:
          start: 13691
          end: 13767
          strand: 1
          srcFeature_id: Id of genomic sample

          exon_2:
          start: 14687
          end: 14720
          strand: 1
          srcFeature_id: Id of genomic sample

# First, create exon features (using Bioperl)
my $exon_1   = new Bio::SeqFeature::Gene::Exon (
   -start         => 13691,
   -end          => 13767,
   -strand      => 1,
   -is_coding => 1
);
 
my $exon_2   = new Bio::SeqFeature::Gene::Exon (
   -start         => 14687,
   -end          => 14720,
   -strand      => 1,
   -is_coding => 1
);
 
# Next, create transcript feature to 'hold' exons (using Bioperl)
my $bioperl_mrna = new Bio::SeqFeature::Gene::Transcript();
 
# Add exons to transcript (using Bioperl)
$bioperl_mrna->add_exon( $exon_1 );
$bioperl_mrna->add_exon( $exon_2 );

Problem 1 - Create and Insert mRNA

The BioPerl object holds the location information, but now we want to create a Modware object and link it to the gene as well as locate it on the chromosome.

     # Now create Modware Feature to 'hold' bioperl object
     my $mrna_feature = new Modware::Feature(
         -type              => 'mRNA',
         -bioperl           => $bioperl_mrna,
         -source            => 'GMOD 2007 Demo',
         -reference_feature => $reference_feature
     );
 
     # Associate mRNA to gene (required for insertion)
     $mrna_feature->gene( $gene_feature );
 
    # inserts object into database
     $mrna_feature->insert();

Problem 2 - Writing the Report

2) Retrieve and print the following report for gene xfile

   symbol: xfile
   synonyms: mulder, scully
   description: A test gene for GMOD meeting
   type: gene
   exon1 start: 13691
   exon1 end: 13767
   exon2 start: 14687
   exon2 end: 14720
   >xfile cds
   ATGGCGTTAGTATTCATGGTTACTGGTTTCGCTACTGATATCACCCAGCGTGTAGGCTGT
   GGAATCGAACACTGGTATTGTATAAATGTTTGTGAATACACTGAGAAATAA

Create new package, GMODWriter, to write the report, this package uses Modware and Bioperl methods.

use Modware::Gene;
use GMODWriter;
 
my $xfile_gene = new Modware::Gene( -name => 'xfile' );
GMODWriter->Write_gene_report( $xfile_gene );

• What's the difference between Modware::Gene and Modware::Feature? Gene is-a Feature.

Problem 2 - Writing the Report

2) Retrieve and print the following report for gene xfile

• The mRNA object contains the Bioperl object
  • Why not just subclass? More flexibility the way shown here

package GMODWriter;
sub Write_gene_report {
my ($self, $gene)      = @_;
my $symbol = $gene->name();
 
my @synonyms = @{ $gene->synonyms() };
my $syn_string  = join ",", @synonyms;
my $description = $gene->description();
my $type        = $gene->type();
# get features associated with the gene that are of type 'mRNA'
my ($mrna)      = grep { $_->type() eq 'mRNA' } @{ $gene->features() };
# use bioperl method to get exons from mRNA
my @exons       = $mrna->bioperl->exons_ordered();
# Modware will return a nice fasta file for you.
my $fasta       = $mrna->sequence( -type => 'cds', -format => 'fasta' );
# Now print the actual report
print "symbol: $symbol\n";
print "synonyms: $syn_string\n";
print "description: $description\n";
print "type: $type\n";
 
my $count = 0;
foreach my $exon (@exons ) {
   $count++;
   print "exon${count} start: ".$exon->start()."\n";
 
   print "exon${count} end: ".$exon->end()."\n";
 
  }
  print "$fasta";
}
 . . .

Problem 3 - Updating a Gene Name

3) Update the gene xfile: change the name symbol to x-file and retrieve the changed record. Regenerate gene report

 use Modware::Gene;
 use Modware::DBH;
 use GMODWriter;
 
 eval{
 
    # get xfile gene
    my $xfile_gene = new Modware::Gene( -name => 'xfile' );
 
    # change the name
    $xfile_gene->name( 'x-file' );
     # write changes to database
    $xfile_gene->update();
 
    # we can use the original object if we want, but instead
    # we refetch from the database to 'prove' the name has been changed
    my $xfile_gene2 = new Modware::Gene( -name => 'x-file' );
    # use our GMODWriter package to write report for x-file
    GMODWriter->Write_gene_report( $xfile_gene2 );
 
 };
 if ($@){
    warn $@;
    new Modware::DBH->rollback();
 }

Problem 4 - Search and Display Results

4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list (organism will vary):

   1323    x-file  Xenopus laevis
   1324    x-men   Xenopus laevis
   1325    x-ray   Xenopus laevis

     use Modware::Gene;
     use Modware::DBH;
     use GMODWriter;
 
     # find genes starting with 'x-'
     my $results = Modware::Search::Gene->Search_by_name( 'x-*' );
 
     # write the search results
     GMODWriter->Write_search_results( $results )

Problem 4 - Search and Display Results

4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list (organism will vary):

   1323    x-file  Xenopus laevis
   1324    x-men   Xenopus laevis
   1325    x-ray   Xenopus laevis

sub Write_search_results {
  my ($self, $itr) = @_;
  # loop through iterator
  while (my $gene = $itr->next) {
    # print the requested information
    print $gene->feature_id . "\t" . $gene->name .
      "\t" . $gene->organism_name . "\n";
  }
}

Problem 5 - Delete a Gene

5) Delete the gene x-ray. Run the search and report again.

   1323    x-file  Xenopus laevis
   1324    x-men   Xenopus laevis

 # get the xray gene
 my $xray = new Modware::Gene( -name => 'x-ray' );
 
# set is_deleted = 1, this will 'hide' the gene from searches,
# also sets the is_available to 0, the gene is no longer visible
# to a search.
 
 $xray->is_deleted(1);
 
 # write change to database
 $xray->update();
 
 # find genes starting with 'x-'
 my $results = Modware::Search::Gene->Search_by_name( 'x-*' );
 
 # write the search results
 GMODWriter->Write_search_results( $results )

Other Modware Highlights

• Easy to write applications with Modware
• Extensible
• Available through Sourceforge
  • http://gmod-ware.sourceforge.net
• Easy to install
• Large unit test coverage
• Current release 0.2-RC1
  • Works with GMOD’s latest release
• Sample script demoed here are available
  • sample_scripts directory

Other Nice Things About Modware

• Bioperl-style documentation
  • http://gmod-ware.sourceforge.net/doc/
  • POD for all methods
• If Chado changes then...
  • Manually change Modware or ...
  • Chado::AutoDBI will automatically adjust to the change, depends on the change
• Can set multiple connections through AutoDBI's set_connection

Coming Attractions

• Support for changing genomic sequence
• ncRNAs
• UTRs
• Onotology modules
• Phenotype Annotations
• Getting a new database handle returns the existing
  • Thinking about configuring modules to set what database handle can be used
• Pass an argument type to the Gene's feature() method
• Type the kind of synonym is being inserted?
  • Possible: trade-off between simplicity and functionality

• Send us your ideas!

Discussion

• How hard is it to extend Modware?
  • Not known absolutely, but generally thought to be not difficult

Acknowlegments

• Rex Chisholm, PhD
• Warren Kibbe, PhD
• Scott Cain
• Brian O’connor
• Sohel Merchant
• Petra Fey
• Pascale Gaudet,
• Karen Pilcher

• BioPerl
• GMOD
• SGD