Glossary
Contents
- 1 AJAX
- 2 API
- 3 CVS
- 4 DAS
- 5 Database
- 6 Database Management System
- 7 Database Schema
- 8 DBMS
- 9 FASTA
- 10 Gene Finder Format
- 11 Generic Feature Format
- 12 General Feature Format
- 13 GFF
- 14 GFF2
- 15 GFF3
- 16 GTF
- 17 Java
- 18 JSON
- 19 Linux
- 20 Middleware
- 21 Operating System
- 22 OS
- 23 Perl
- 24 RDBMS
- 25 Relational
- 26 Relational Database Management System
- 27 SAM
- 28 SAMtools
- 29 Schema
- 30 SQL
- 31 SVN
- 32 Unix
- 33 XML
This glossary explains terms that
- are specific to the GMOD project, or
- are computing terms that are used in the GMOD project.
This glossary does not define biology terms.
AJAX
AJAX is a web user interface technology used in some GMOD Components. It is used to provide a richer user experience than was typically available during the first 10 years of the web. AJAX stands for Asynchronous Javascript and XML.
See Also:
API
API stands for Application Programming Interface. An API is a well-defined programmatic interface to some resource. That is, it is an interface meant to be used by other programs to access that resource. It is distinct and sometime complementary to a Graphical User Interface or GUI, which is a direct user interface to a resource.
CVS
CVS is a source code control system that used to be used by most of GMOD. Source code control systems, also known as revision control or version control systems are used to record changes to computer files. GMOD now uses SVN.
See Also:
DAS
See Distributed Annotation System
Database
A database can be any set of organized data that is readable by a computer. It can be anywhere from an implementation of a database schema in a particular database management system to regular files that have a defined format.
For example, the database behind the FlyBase web site contains data on drosopholids, and uses the Chado schema and the PostgreSQL database management system.
See also:
Database Management System
Database management systems (DBMSs) are software systems that can manage data. PostgreSQL, MySQL, Oracle and Sybase are all examples of DBMSs. DBMSs are containers of databases. That is, they are the systems that manage databases, which is distinct from the data that they manage.
Most DBMSs are relational, which is a particular way of representing data. All DBMSs that GMOD is concerned with are relational, so GMOD uses the termsdatabase management system and relational database management system (RDBMS) interchangeably.
See also:
Database Schema
A database schema is the design of a particular database, independent of its contents. Chado is an example of a database schema. Designs (like Chado) can be reused across multiple databases.
See also:
DBMS
See Database Management System.
FASTA
FASTA is a widely used text-based data format for representing nucleic acid and peptide sequence data. FASTA entries start with a header line, followed by the sequence on the immediately following lines. The header line starts with the sequence identifier. It can also contain additional information, which is often pipe ("|") separated.
A basic example, showing "ctg123", a DNA sequence that is 338 nucleotides long:
>ctg123 cttctgggcgtacccgattctcggagaacttgccgcaccattccgccttg tgttcattgctgcctgcatgttcattgtctacctcggctacgtgtggcta tctttcctcggtgccctcgtgcacggagtcgagaaaccaaagaacaaaaa aagaaattaaaatatttattttgctgtggtttttgatgtgtgttttttat aatgatttttgatgtgaccaattgtacttttcctttaaatgaaatgtaat cttaaatgtatttccgacgaattcgaggcctgaaaagt
FASTA entries can be included at the end of GFF3 files.
See also:
- FASTA format at Wikipedia.
Gene Finder Format
A former name for GFF.
Generic Feature Format
See GFF.
General Feature Format
A former name for GFF.
GFF
GFF is a standard file format for storing genomic features in a text file. GFF stands for Generic Feature Format. GFF files are plain text, 9 column, tab-delimited files. GFF databases also exist. They use a schema custom built to represent GFF data. GFF is frequently used in GMOD for data exchange and representation of genomic data.
There are two versions of GFF supported in GMOD: GFF3 and GFF2. GFF2 is now deprecated.
See also:
- GFF - all things GFF and GFF3
GFF2
GFF2 is a supported GFF format in GMOD, but it is now deprecated and if you have a choice you should use GFF3. Unfortunately, data is sometimes only available in GFF2 format. GFF2 has a number of shortcomings compared to GFF3.
See also:
GFF3
GFF3 is the most recent version of the GFF format. It has many advantages over the now deprecated GFF2 and should be used in favor of GFF2 whenever possible.
See also:
GTF
GTF, is genomic annotation file format that is very similar to GFF2 and is sometimes referred to as GFF2.5. GTF is not a supported format in GMOD so if you have a GTF file you'll need to convert it to GFF3.
See also:
- GFF
- The GTF section of the GFF page.
Java
Java is arguably the world's most popular programming language but it is not as popular for command-line work on Unix as Perl. It's encountered in GMOD primarily as a language to construct user interfaces (e.g. Apollo).
See also:
- Category:Java - GMOD pages tagged as related to Java.
JSON
JSON is an acronym for JavaScript Object Notation, a lightweight data-interchange format. It is used in GMOD in Galaxy and JBrowse.
See also:
Linux
Linux is an open source operating system that is based on he Unix operating system. Linux is the default operating system for GMOD.
See also:
- Computing Requirements
- Category:Linux - List of GMOD pages tagged as related to Linux.
Middleware
Middleware is software that connects other software components so they can talk together. You can think of it as project plumbing. Like plumbing, it is hard to do well, and people take it for granted until it does not work.
See also:
- Category:Middleware - List of GMOD pages tagged as related to middleware.
Operating System
An operating system (OS) is the software that controls a computer and manages the sharing of resources on that computer. Example operating systems are Microsoft Windows and Linux.
See also:
OS
See Operating System.
Perl
Perl is the programming language most used in the bioinformatics realm, and it is the language most used by GMOD developers. It is well-suited to text and data processing and is also characterized by an extensive open source library, so it's highly functional. Many of GMOD components use BioPerl, a bioinformatics toolkit written in Perl.
Some parts of GMOD, like GBrowse, can be extended or customized using Perl but beginners' skills in Perl is sufficient for this work.
See also:
- Perl Home Page
- Perl's open source library repository.
- Category:Perl - GMOD pages tagged as related to Perl.
RDBMS
See Database Management System.
Relational
Most Database Management Systems (DBMSs) are relational, which is a particular way of representing data. All DBMSs that GMOD is concerned with are relational, so GMOD uses the terms database management system and relational database management system (RDBMS) interchangeably.
See also:
Relational Database Management System
See Relational and Database Management System.
SAM
Sequence Alignment/Map format. SAM is a text format for Next Generation Sequencing data. It is a part of SAMtools. GBrowse 2 has an adaptor that can read SAM data.
SAMtools
SAMtools is a set of formats and programs for storing, manipulating, and accessing Next Generation Sequencing data.
Schema
See Database Schema
SQL
SQL is a standard query language used with relational database management systems (DBMSs). Is is used to update and retrieve data that is in a database.
SQL is generally similar for different DBMSs but varies in many details from one DBMS to another.
SVN
SVN is a source code control system that is used by most of GMOD. Source code control systems, also known as revision control or version control systems are used to record changes to computer files. SVN is short for Subversion. GMOD converted from CVS to SVN on 2009/09/15.
GMOD's main source code repository is at SourceForge. Subversion explains how to both download and update the main GMOD repository at SourceForge.
See Also:
Unix
Unix is a group of operating systems that are descended from the original Unix operating system developed in the 1970s. This includes Solaris, HP-UX, Linux, Mac OS X, and many others.
XML
XML is an acronym for eXtensible Markup Language, a data format used primarily for sharing data. It looks similar to HTML, but has a much tighter syntax than does HTML.
See also: