Difference between revisions of "GMOD Online Training 2014/GBrowse syn Tutorial"

From GMOD
Jump to: navigation, search
(Installing GBrowse_syn)
(Configurations Files)
 
(29 intermediate revisions by the same user not shown)
Line 14: Line 14:
 
==GBrowse_syn Introduction==
 
==GBrowse_syn Introduction==
  
[[Media:Gbrowse_syn_Intro-2013-Summer-School.pptx|Introductory talk on GBrowse_syn]]
+
[[Media:GBrowse_syn_Intro.pptx|Introductory talk on GBrowse_syn]]
  
 
==Installing GBrowse_syn==
 
==Installing GBrowse_syn==
Line 37: Line 37:
 
'''3) Upgrade GBrowse'''
 
'''3) Upgrade GBrowse'''
 
  $ <span class=enter>cd ~/GBrowse</span>
 
  $ <span class=enter>cd ~/GBrowse</span>
  $ <span class=enter>./Build.PL</span>
+
  $ <span class=enter>perl Build.PL</span>
<div class=emphasisbox><b>
+
 
While running the command below:</b>
+
<div class=emphasisbox>
 +
<table><tr><td width=60px>[[File:alert.png]]</td>  
 +
<td><b>While running the command below:</b>
 
* Select /data/etc/gbrowse2/ when prompted (instead of /etc/gbrowse2)
 
* Select /data/etc/gbrowse2/ when prompted (instead of /etc/gbrowse2)
* Select <span class=tt>R (Replace)</span> when prompted
+
* Select <span class=tt>R (Replace)</span> when prompted, except for your *.conf files, which you may want to preserve to save your work from this morning.
</b></div>
+
</td></tr></table>
 +
</div>
  
 
  $ <span class=enter>sudo ./Build install</span>
 
  $ <span class=enter>sudo ./Build install</span>
 
'''4) Create a symbolic link to the GBrowse temp folder (for caching of sessions, images, etc)'''
 
$ <span class=enter>cd /var/www</span>
 
$ <span class=enter>ln -s ../tmp</span>
 
  
 
==Running GBrowse for the First Time==
 
==Running GBrowse for the First Time==
Line 84: Line 83:
  
 
  $ <span class="enter">mysql -u root -p</span>
 
  $ <span class="enter">mysql -u root -p</span>
  Enter password: <span class="enter">****************</span>
+
  Enter password: <span class="enter">gbsyndemo</span>
 
<pre>  
 
<pre>  
 
Welcome to the MySQL monitor.  Commands end with ; or \g.
 
Welcome to the MySQL monitor.  Commands end with ; or \g.
Line 140: Line 139:
 
Load the database with the script <tt>gbrowse_syn_load_alignments_msa.pl</tt>, which is automatically installed along with GBrowse.  See the [GBrowse_syn scripts] page for details on the options for the script.
 
Load the database with the script <tt>gbrowse_syn_load_alignments_msa.pl</tt>, which is automatically installed along with GBrowse.  See the [GBrowse_syn scripts] page for details on the options for the script.
  
  $ <span class="enter">zcat rice.aln.gz | gbrowse_syn_load_alignments_msa.pl -u root -p ******* -d rice_synteny -c -v -</span>
+
  $ <span class="enter">zcat rice.aln.gz | gbrowse_syn_load_alignments_msa.pl -u root -p gbsyndemo -d rice_synteny -c -v -</span>
  
 
There are 185 alignment blocks, it takes a moment to load
 
There are 185 alignment blocks, it takes a moment to load
Line 219: Line 218:
 
</pre>
 
</pre>
 
<div class="emphasisbox">
 
<div class="emphasisbox">
Note: the species databases are actually using the [[GFF3]] flat file, in-memory adapter
+
Note: the species databases are actually using the [[GFF3]] in-memory (file) adapter
 
</div>
 
</div>
  
Line 233: Line 232:
 
[[Image:GBrowse_synWe_made_it1.png|thumb|none|800px]]
 
[[Image:GBrowse_synWe_made_it1.png|thumb|none|800px]]
  
'''4) Click on the first example, you should (eventually) see:'''
+
'''4) Click on the first example, you should see:'''
  
 
[[Image:GBrowse_synWe_made_it2.png|thumb|none|800px]]
 
[[Image:GBrowse_synWe_made_it2.png|thumb|none|800px]]
  
'''5) Try out a few user interface features:'''
+
====Try out a few user interface features====
  
 
* mouse over one of the genes:
 
* mouse over one of the genes:
 
[[File:Gbrowse_synBubble1.png]]
 
[[File:Gbrowse_synBubble1.png]]
 
* Click on one of the bold blue highlighted section titles.  This takes you to a contextual help page on the GMOD wiki.
 
* Click on one of the bold blue highlighted section titles.  This takes you to a contextual help page on the GMOD wiki.
<!--* Click and drag on the overview panel.  This will trigger rubber band selection to recenter or resize the displayed image-->
+
* Click and drag on the overview panel.  This will trigger rubber band selection to recenter or resize the displayed image
 
+
* Select "chain alignments"
 +
This:<br clear=all />
 +
[[File:before_chain.png|border|650px]]
  
 +
Will become this:<br clear=all />
 +
[[File:after_chain.png|border|650px]]
  
 
===Speeding up the Browser===
 
===Speeding up the Browser===
Line 283: Line 286:
 
  load time: 12.02s
 
  load time: 12.02s
  
'''3) Modify the following stanza in the file <tt>rice_synteny.conf</tt> in cd /etc/gbrowse2/synteny/.'''   
+
'''3) The configuration files are write-protected by default:
 +
<pre>$ ls -al
 +
total 20
 +
drwxr-xr-x 2 ubuntu ubuntu 4096 May 22 12:42 .
 +
drwxr-xr-x 7 ubuntu ubuntu 4096 May 22 12:30 ..
 +
-r--r--r-- 1 root  root  1405 May 22 12:29 oryza.synconf
 +
-r--r--r-- 1 root  root    519 May 22 12:29 rice_synteny.conf
 +
-r--r--r-- 1 root  root    698 May 22 12:29 wild_rice_synteny.conf
 +
</pre>
 +
You will need to make them writable:
 +
 
 +
$ sudo chmod 644 *
 +
 
 +
'''4) Edit the following stanza in the file <tt>rice_synteny.conf</tt> in cd /etc/gbrowse2/synteny/.'''   
 
This will convert your data source from a flat file database to a MySQL relational database.
 
This will convert your data source from a flat file database to a MySQL relational database.
  
Line 292: Line 308:
 
  # to
 
  # to
 
  db_args      = -adaptor DBI::mysql
 
  db_args      = -adaptor DBI::mysql
                        -dsn dbi:mysql:rice
+
                -dsn dbi:mysql:rice
  
'''4) repeat for <tt>wild_rice_synteny.conf</tt>'''
+
'''5) repeat for <tt>wild_rice_synteny.conf</tt>, using the DSN dbi:mysql:wild_rice'''
  
 
==Using Non-alignment Data==
 
==Using Non-alignment Data==
Line 307: Line 323:
 
  $ <span class="enter">mkdir ~/data</span>
 
  $ <span class="enter">mkdir ~/data</span>
 
  $ <span class="enter">cd data</span>
 
  $ <span class="enter">cd data</span>
  $ <span class="enter">wget ftp://ftp.gmod.org/pub/gmod/GBrowse_syn/orthocluster.tar.gz</span>
+
  $ <span class="enter">wget https://s3.amazonaws.com/ftp.gmod.org/GBrowse_syn/orthocluster.tar.gz</span>
 
  $ <span class="enter">tar zxvf orthocluster.tar.gz</span>  
 
  $ <span class="enter">tar zxvf orthocluster.tar.gz</span>  
 
  ORTHOCLUSTER/
 
  ORTHOCLUSTER/
Line 368: Line 384:
 
db_args      = -dsn dbi:mysql:bri
 
db_args      = -dsn dbi:mysql:bri
  
tmpimages  = /tmp/gbrowse2
+
tmpimages  = /gbrowse2/tmp/gbrowse_syn
  
 
[CG]
 
[CG]
Line 444: Line 460:
 
  $ cd ~/data/ORTHOCLUSTER/conf
 
  $ cd ~/data/ORTHOCLUSTER/conf
 
  $ sudo cp *.conf /data/etc/gbrowse2/synteny
 
  $ sudo cp *.conf /data/etc/gbrowse2/synteny
+
 
 
===The Alignment Data===
 
===The Alignment Data===
 
The file <tt>orthocluster.txt</tt> contains the synteny data.  The first few lines are shown below.  The first 12 fields in each row specify information about the synteny block in each species and the series of numbers are orthologous gene coordinate pairs that are used for linking orthologs with grid-lines in the GBrowse_syn display.  See 'Alignment Data' under [[#Further Reading|Further Reading]] below for more details of this loading format.
 
The file <tt>orthocluster.txt</tt> contains the synteny data.  The first few lines are shown below.  The first 12 fields in each row specify information about the synteny block in each species and the series of numbers are orthologous gene coordinate pairs that are used for linking orthologs with grid-lines in the GBrowse_syn display.  See 'Alignment Data' under [[#Further Reading|Further Reading]] below for more details of this loading format.

Latest revision as of 19:05, 22 May 2014

This tutorial on GBrowse syn was taught by Sheldon McKay as part of the GMOD_Online_Training_2014.

The starting image for this tutorial is GMOD 2014 online school - ami-907e97f8. It can be run as a micro or small instance.

  • If you are not using the Amazon EC2 instance, the system paths may vary from those described below.

 

GBrowse_syn is a GBrowse-based synteny browser designed to display multiple genomes, with a central reference species compared to two or more additional species. It is included with the standard GBrowse package (version 1.69 and later).

GBrowse_syn at The Arabidopsis Information Resource (TAIR)


GBrowse_syn Introduction

Introductory talk on GBrowse_syn

Installing GBrowse_syn

GBrowse_syn is part of the GBrowse2 package and was pre-installed when you went through the GBrowse 2.0 installation.

Update GBrowse to get recent changes:

1) Get a copy of the Gbrowse github repository

$ git clone https://github.com/GMOD/GBrowse.git
Cloning into 'GBrowse'...
remote: Reusing existing pack: 40784, done.
remote: Total 40784 (delta 0), reused 0 (delta 0)
Receiving objects: 100% (40784/40784), 26.98 MiB | 5.93 MiB/s, done.
Resolving deltas: 100% (25613/25613), done.

2) Clean up the synteny conf folder (the may be some older junk lying around)

$ sudo rm -f /data/etc/gbrowse2/synteny/*

3) Upgrade GBrowse

$ cd ~/GBrowse
$ perl Build.PL
Alert.png While running the command below:
  • Select /data/etc/gbrowse2/ when prompted (instead of /etc/gbrowse2)
  • Select R (Replace) when prompted, except for your *.conf files, which you may want to preserve to save your work from this morning.
$ sudo ./Build install

Running GBrowse for the First Time

Point your browser to http://ec2-##-##-##-##.compute-1.amazonaws.com/cgi-bin/gb2/gbrowse_syn

Welcome screen

This is the welcome screen you should see after installing a new copy of GBrowse_syn with no configured data sources. It contains instructions on how to set up the example data source provided with the distribution.

Setting up the sample data

  • Sample data and configuration information for GBrowse_syn come pre-packaged with GBrowse.
  • The example we will use is a two-species comparison of rice (Oryza sativa) and one of its wild relatives*
*Data courtesy of Bonnie Hurwitz

Setting up the Alignment Database

The alignment, or joining database will contain the sequence alignments between the two rice species. It will be in a MySQL database. If mysql is not installed on your server, you can install it as follows:

Debian-based Linux distributions:

$ sudo apt-get update
$ sudo apt-get install mysql-server mysql-client

RedHat-based Linux distributions

$ sudo yum install mysql

Note: You set the mysql root password at the time of installation. Use 'gbsyndemo' or else be sure to remember the password for use later.

1) Create a MySQL database to hold the alignment data

$ mysql -u root -p
Enter password: gbsyndemo
 
Welcome to the MySQL monitor.  Commands end with ; or \g.
 Your MySQL connection id is 37
 Server version: 5.1.37-1ubuntu5.1 (Ubuntu)

 Type 'help;' or '\h' for help. Type '\c' to clear the current input statement.

 mysql> create database rice_synteny;
 Query OK, 1 row affected (0.00 sec)

 mysql>

2) Give read-only (SELECT privileges in SQL) to the default apache user www-data. We can do this for all of the MySQL databases, since they are all for web applications

mysql> GRANT SELECT on *.* TO 'www-data'@'localhost';
Query OK, 0 rows affected (0.00 sec)
mysql> quit

3) Load the sample alignment database. You need to have root-level access (be a sudoer) for some of the steps below.

$ cd /data/var/lib/gbrowse2/databases/gbrowse_syn/alignments

Have a look at the first few lines of the data:

$ zcat rice.aln.gz | head -20
 CLUSTAL W(1.81) multiple sequence alignment W(1.81)


 rice-3(+)/16598648-16600199      ggaggccggccgtctgccatgcgtgagccagacggggcgggccggagacaggccacgtgg
 wild_rice-3(+)/14467855-14469373 gggggccgg------------------------------------agacaggccacgtgg
                                  ** ******                                    ***************


 rice-3(+)/16598648-16600199      ccctgccccgggctgttgacccactggcacccctgtcccgggttgtcgccctcctttccc
 wild_rice-3(+)/14467855-14469373 ccctgccccgggctgttgacccactggcacccctgtcccgggttgtcgccctcctttccc
                                  ************************************************************


 rice-3(+)/16598648-16600199      cgccatgctctaagtttgctcctcttctcgaacttctctctttgattcttcacgtcctct
 wild_rice-3(+)/14467855-14469373 cgccatgctctaagtttgctcctcttctcgaacttctctctttgattcttcacgtcctct
                                  ************************************************************


 rice-3(+)/16598648-16600199      tggagcctccccttctagctcgatcacgctctgctcttccgcttggaggctggcaaaact
 wild_rice-3(+)/14467855-14469373 tggagcctccccttctagctcgatcgcgctctgctcttccgcttggaggctggcaaaact

The format is CLUSTALW. This is a formatting convention; it does not mean CLUSTALW was used to generate the alignment data. See Further Reading below for more information on data loading and the meta-data in the sequence names

Load the database with the script gbrowse_syn_load_alignments_msa.pl, which is automatically installed along with GBrowse. See the [GBrowse_syn scripts] page for details on the options for the script.

$ zcat rice.aln.gz | gbrowse_syn_load_alignments_msa.pl -u root -p gbsyndemo -d rice_synteny -c -v -

There are 185 alignment blocks, it takes a moment to load

Setting up the Configuration Files

  • The configuration files required for this data source are pre-installed with GBrowse, in /data/etc/gbrowse2/synteny/.
  • There are config files for two species, rice_synteny.conf and wild_rice_synteny.conf, and the joining config file, oryza.synconf. The latter file has been disabled by appending a '.disabled' extension to the file name.

The joining config file, oryza.synconf:

[GENERAL]
description =  BLASTZ alignments for Oryza sativa

====Sample Configuration Files====
# The synteny database
join        = dbi:mysql:database=rice_synteny;host=localhost

# This option maps the relationship between the species data sources, names and descriptions
# The value for "name" (the first column) is the symbolic name that gbrowse_syn users to identify each species.
# This value is also used in two other places in the gbrowse_syn configuration:
# the species name in the "examples" directive and the species name in the .aln file
# The value for "conf. file" is the basename of the corresponding gbrowse .conf files.
# This value is also used to identify the species configuration stanzas at the bottom of the configuration file.

#                 name          conf. file            Description
source_map =      rice          rice_synteny          "Domesic Rice (O. sativa)"
                  wild_rice     wild_rice_synteny     "Wild Rice"

tmpimages     = /tmp/gbrowse2
imagewidth    = 800
stylesheet    = /gbrowse2/css/gbrowse_transparent.css
cache time    = 1

config_extension = conf

# example searches to display
examples = rice 3:16050173..16064974
           wild_rice 3:1..400000

zoom levels = 5000 10000 25000 50000 100000 200000 400000

# species-specific databases
[rice_synteny]
tracks    = EG
color     = blue

[wild_rice_synteny]
tracks    = EG
color     = red

A sample species config file, rice_synteny.conf:

[GENERAL]
description   = Domestic rice chromosome 3
db_adaptor    = Bio::DB::SeqFeature::Store
db_args       = -adaptor memory
                -dir    /var/www/gbrowse2/databases/gbrowse_syn/rice


# Web site configuration info
tmpimages   = /tmp/gbrowse2

[EG]
feature      = gene:ensembl
glyph        = gene
height       = 10
bgcolor      = peachpuff
fgcolor      = hotpink
description  = 0
label        = 0
category     = Transcripts
key          = ensembl gene
balloon hover = Hello, my name is $name!

Note: the species databases are actually using the GFF3 in-memory (file) adapter

Activating the Oryza Data Source

1) Renaming the configuration file

$ cd /data/etc/gbrowse2/synteny
$ sudo mv oryza.synconf.disabled.conf oryza.synconf

3) Point your browser to http://ec2-##-##-##-##.compute-1.amazonaws.com/cgi-bin/gb2/gbrowse_syn/oryza (or your own URL if you are not using the Amazon EC2 instance). You should see:

GBrowse synWe made it1.png

4) Click on the first example, you should see:

GBrowse synWe made it2.png

Try out a few user interface features

  • mouse over one of the genes:

Gbrowse synBubble1.png

  • Click on one of the bold blue highlighted section titles. This takes you to a contextual help page on the GMOD wiki.
  • Click and drag on the overview panel. This will trigger rubber band selection to recenter or resize the displayed image
  • Select "chain alignments"

This:
Before chain.png

Will become this:
After chain.png

Speeding up the Browser

You can speed up the image loading time by putting your species' GFF3 data into relational MySQL databases.

1) Create a database for each of the GFF data files (rice.gff3 and wild_rice.gff3).

$ mysql -uroot -pgbsyndemo
mysql> create database rice;
Query OK, 1 row affected (0.00 sec)
mysql> create database wild_rice;
Query OK, 1 row affected (0.00 sec)
mysql> quit

2) Populate the databases using the Loading bp_seqfeature_load (pre-installed as part of BioPerl with GBrowse). This will load the GFF3 data into a MySQL relational database. Note the MySQL user will root-level privileges.

$ cd /var/lib/gbrowse2/databases/gbrowse_syn/rice
$ bp_seqfeature_load -u root -p gbsyndemo -d rice -c -f rice.gff3
loading rice.gff3...
Building object tree...
0.55s0s
Loading bulk data into database... 0.73s
load time: 11.99s
$ cd ../wild_rice
$ bp_seqfeature_load -u root -p gbsyndemo -d wild_rice -c -f wild_rice.gff3
loading wild_rice.gff3...
Building object tree...
0.55s7a
Loading bulk data into database... 0.69s
load time: 12.02s

3) The configuration files are write-protected by default:

$ ls -al
total 20
drwxr-xr-x 2 ubuntu ubuntu 4096 May 22 12:42 .
drwxr-xr-x 7 ubuntu ubuntu 4096 May 22 12:30 ..
-r--r--r-- 1 root   root   1405 May 22 12:29 oryza.synconf
-r--r--r-- 1 root   root    519 May 22 12:29 rice_synteny.conf
-r--r--r-- 1 root   root    698 May 22 12:29 wild_rice_synteny.conf

You will need to make them writable:

$ sudo chmod 644 *

4) Edit the following stanza in the file rice_synteny.conf in cd /etc/gbrowse2/synteny/. This will convert your data source from a flat file database to a MySQL relational database.

# from
db_args       = -adaptor memory
                -dir    /var/www/html/gbrowse/databases/gbrowse_syn/rice
# to
db_args       = -adaptor DBI::mysql
               -dsn dbi:mysql:rice

5) repeat for wild_rice_synteny.conf, using the DSN dbi:mysql:wild_rice

Using Non-alignment Data

This example uses gene orthology-based synteny blocks* based created by OrthoCluster for three nematode species, C. elegans, C. briggsae and P. pacificus.

*Data courtesy of Jack Chen and Ismael Vergera

1) Download and unpack the data archive file orthocluster.tar.gz.

$ mkdir ~/data
$ cd data
$ wget https://s3.amazonaws.com/ftp.gmod.org/GBrowse_syn/orthocluster.tar.gz
$ tar zxvf orthocluster.tar.gz 
ORTHOCLUSTER/
ORTHOCLUSTER/conf/
ORTHOCLUSTER/gff/
ORTHOCLUSTER/orthocluster.txt
ORTHOCLUSTER/gff/bri.gff3
ORTHOCLUSTER/gff/ele.gff3
ORTHOCLUSTER/gff/ppa.gff3
ORTHOCLUSTER/conf/bri.conf
ORTHOCLUSTER/conf/ele.conf
ORTHOCLUSTER/conf/orthocluster.synconf
ORTHOCLUSTER/conf/ppa.conf

Species Gene Annotations

In the gff directory, there are GFF3 annotations for three species

$ head -20 ele.gff3

##gff-version 3 
##sequence-region I 1 15072421
##sequence-region II 1 15279324
##sequence-region III 1 13783685
##sequence-region IV 1 17493784
##sequence-region V 1 20924143
##sequence-region X 1 17718854
IV	curated	mRNA	11012483	11015853	.	-	.	ID=F13H10.3a;Name=F13H10.3a
IV	curated	CDS	11012483	11012648	.	-	1	Parent=F13H10.3a
IV	curated	CDS	11012694	11012932	.	-	0	Parent=F13H10.3a
IV	curated	CDS	11013456	11013667	.	-	2	Parent=F13H10.3a
IV	curated	CDS	11013719	11013817	.	-	2	Parent=F13H10.3a
IV	curated	CDS	11013878	11014105	.	-	2	Parent=F13H10.3a
IV	curated	CDS	11014195	11014434	.	-	2	Parent=F13H10.3a
IV	curated	CDS	11014489	11014646	.	-	1	Parent=F13H10.3a
IV	curated	CDS	11014695	11014792	.	-	0	Parent=F13H10.3a
IV	curated	CDS	11014841	11015114	.	-	1	Parent=F13H10.3a
IV	curated	CDS	11015624	11015724	.	-	0	Parent=F13H10.3a
IV	curated	CDS	11015821	11015853	.	-	0	Parent=F13H10.3a
II	curated	mRNA	2824413	2824910	.	+	.	ID=K12H6.9;Name=K12H6.9

2) Create a new data for C. elegans

$ mysql -uroot -pgbsyndemo -e 'create database ele'

3) Create and load a Bio::DB:SeqFeature::Store database for C. elegans (ele).

We use screen so that we can get the time-consuming loading script started and then use Ctrl-A D to set the screen running in the background' and move on to other steps.

$ screen bp_seqfeature_load -u root -p gbsyndemo -d ele -c -f ele.gff3

4) Repeat steps 2 and 3 for the other two species (bri and ppa).

Configurations Files

The conf has configuration files for each of the species and the alignment database.

Example species configuration:

[GENERAL]
description   = C. briggsae
db_adaptor    = Bio::DB::SeqFeature::Store
db_args       = -dsn dbi:mysql:bri

tmpimages   = /gbrowse2/tmp/gbrowse_syn

[CG]
label        = 1
description  = 1
feature      = mRNA
category     = Genes
glyph        = processed_transcript
font2color   = blue
height       = 6
key          = Gene Models
bgcolor      = sub {
  my $flip = pop->panel->flip;
  my $strand = shift->strand;
  return $strand < 0 ? 'violet' : 'turquoise' if $flip;
  return $strand > 0 ? 'violet' : 'turquoise';
 }

# draw genes differently for segments > 100Kb
[CG:100001]
label        = 0
description  = 0
glyph        = generic
strand_arrow = 1

The alignment configuration:

[GENERAL]
description =  OrthoCluster Perfect Synteny Blocks

# The synteny database
join        = dbi:mysql:orthocluster

#                 symbolic src   config file (".conf")    Description
source_map =      ele            ele                      "C. elegans" 
                  bri            bri                      "C. briggsae"
                  ppa            ppa                      "P. pacificus"


# web site configuration info
tmpimages     = /tmp/gbrowse2
imagewidth    = 800
stylesheet    = /gbrowse2/css/gbrowse_transparent.css


# The extension of species config files
# can also use .syn (the default)
config_extension = conf

# sparse data, use all coordinates
grid coordinates  = exact

# example searches to display
examples = ele X:402000..426999
           bri chrX:255000..275000

zoom levels = 5000 10000 25000 50000 100000 200000 400000 1000000

# species-specific databases
[ele]
tracks    = CG 
color     = green

[bri]
tracks    = CG
color     = blue

[ppa]
tracks    = CG
color     = red

5) Install the configuration files

$ cd ~/data/ORTHOCLUSTER/conf
$ sudo cp *.conf /data/etc/gbrowse2/synteny

The Alignment Data

The file orthocluster.txt contains the synteny data. The first few lines are shown below. The first 12 fields in each row specify information about the synteny block in each species and the series of numbers are orthologous gene coordinate pairs that are used for linking orthologs with grid-lines in the GBrowse_syn display. See 'Alignment Data' under Further Reading below for more details of this loading format.

bri	chrI	176154	183558	+	.	ppa	Ppa_Contig88	27212	30786	+	.	176154	27212	177594	30786	182118	27212	183558	30786	|	30786	183558	27212	182118	30786	177594	27212	176154
bri	chrI	778780	799223	+	.	ppa	Ppa_Contig88	533454	542961	-	.	778780	539924	786778	542961	789497	533454	799223	538726	|	538726	799223	533454	789497	542961	786778	539924	778780
bri	chrI	986150	994698	+	.	ppa	Ppa_Contig77	29481	45600	-	.	986150	37055	989649	45600	991428	29481	994698	36608	|	36608	994698	29481	991428	45600	989649	37055	986150
bri	chrI	1453793	1461931	+	.	ppa	Ppa_Contig132	156183	165414	-	.	1453793	163110	1456404	165414	1456712	160849	1457637	162712	1458361	160204	1459245	160815	1459468	159346	1459854	160000	1459962	156183	1461931	159022	|	159022	1461931	156183	1459962	160000	1459854	159346	1459468	160815	1459245	160204	1458361	162712	1457637	160849	1456712	165414	1456404	163110	1453793

6) Create and load the alignment the alignment database. The gbrowse_syn_load_alignment_database.pl script is pre-installed with GBrowse.

$ cd ..
$ mysql -uroot -pgbsyndemo -e 'create database orthocluster'
$ gbrowse_syn_load_alignment_database.pl -u root -p gbsyndemo -d orthocluster -c -v orthocluster.txt

7) Go back to your browser and reload the rice page. There should now be a second data source in a pull-down menu.

GBrowse synPulldown1.png

8) Select the other data source and start browsing!

Gbrowse synEtfinit.png

Further Reading

A Note on Whole Genome Alignments

The focus of the section of the course is on dealing with alignment or synteny data and using GBrowse_syn. However, how to generate whole genome alignments, identify orthologous regions, etc., are the subject of considerable interest, so some background reading is listed below:

Documentation

There is detailed documentation on the GMOD wiki for how to install, configure and use GBrowse_syn. To get started, browse these pages: