GMOD Middleware

Middleware for Chado databases

Ongoing Documentation

This page has been temporarily created by the GMOD developers for the purposes of discussing Chado and middleware for Chado. It will be moved to a permanent location shortly.

Middleware Evaluation January 2007

A group of some 50 GMOD developers met at the annual meeting to discuss middleware. This one day meeting had the following general goals:

To educate GMOD programmers on methods and practices for Middleware
To facilitate discussion on the best methods
To guide GMOD to a uniform Middleware layer
To generate this central reference document for Middleware projects,
- Platform information
- Strengths & weaknesses of different Middleware packages

Introduction

One of the key characteristics of the GMOD software project is the variety of approaches and components that it supports. This applies to applications, database schemas, as well as to middleware, a software layer that mediates the exchange of data between the applications and the databases. Despite this diversity certain applications and schemas have emerged as key supported components in GMOD, such as the GBrowse application and the Chado schema, to name just two. However, a consensus view has not emerged with respect to middleware, and there are certainly a number of different middleware packages that have been used in the GMOD world, coming from within this world and from the larger world of open source.

In late 2006 the GMOD developers took note of the large number of middleware packages in use and elected to embark on a short-term study to evaluate and compare these packages. The primary motivation here was to select or recommend certain packages over others specifically within the GMOD context. The assumption is that making such recommendations will serve to focus the developers' effort on a smaller number of packages. Clearly it's also assumed that such a focus will inevitably lead to greater support for and use of those recommended packages, and that all will GMOD will benefit.

Another purpose of this study is to educate GMOD programmers on best practices concerning the use and development of middleware. It's expected that common agreement on these practices will lead to the development of more effective software as well as the best use of the software in practice. Finally, this study should generate a central reference document on these different middleware packages used in GMOD. This reference will contain platform- and language-specific information as well as descriptions of the strengths and weaknesses of the packages that can be used by GMOD developers when considering middleware.

General Evaluation Criteria

The GMOD developers proposed that each presenter provide some basic information about each middleware package, both general and technical. In addition each middleware application was asked to address a set of sample problems, shown below. These example problems are thought to typify some of the common functions that the scientist may need when working with their own database. It was understood that not all software would be able to handle all aspects of the sample problems and this demonstration was not intended to be live.

Problem 1

Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.

Note:

The coordinates are given in exact coordinates.
Use the organism_id for your organism
Store description in the chado table featureprop
A sequence in fasta format (see Fake Chromosome) should be loaded as genomic sequence, either chromosome or contig -- this will be used as a srcfeature in featureloc

Gene descriptions:

symbol: xfile
synonyms: mulder, scully
description: A test gene for GMOD meeting
mRNA Feature
     exon_1: 
       start: 13691
       end: 13767
       strand: 1
       srcFeature_id: Id of genomic sample
     exon_2: 
       start: 14687
       end: 14720
       strand: 1
       srcFeature_id: Id of genomic sample

symbol: x-men
synonyms: wolverine
  mRNA Feature
     exon_1: 
       start: 12648
       end: 13136
       strand: 1
       srcFeature_id: Id of genomic sample

symbol: x-ray
synonyms: none
     exon: 
       start: 1703
       end: 1900
       strand: 1
       srcFeature_id: Id of genomic sample

Problem 2

Retrieve and print the following report for gene xfile (the coding sequence and exon coordinates are derived from the associated mRNA feature). The results should resemble the following:

symbol: xfile
synonyms: mulder, scully
description: A test gene for GMOD meeting
type: gene
exon1 start: 13691
exon1 end: 13767
exon2 start: 14687
exon2 end: 14720
>xfile cds 
ATGGCGTTAGTATTCATGGTTACTGGTTTCGCTACTGATATCACCCAGCGTGTAGGCTGT
GGAATCGAACACTGGTATTGTATAAATGTTTGTGAATACACTGAGAAATAA

Problem 3

Update the gene xfile: change the name symbol to x-file and retrieve the changed record. Regenerate the report from Problem 1. The results should resemble the following:

symbol: x-file
synonyms: mulder, scully
description: A test gene for GMOD meeting
type: gene
exon1 start: 13691
exon1 end: 13767
exon2 start: 14687
exon2 end: 14720
>x-file cds
ATGGCGTTAGTATTCATGGTTACTGGTTTCGCTACTGATATCACCCAGCGTGTAGGCTGT
GGAATCGAACACTGGTATTGTATAAATGTTTGTGAATACACTGAGAAATAA

Problem 4

Search for all genes with symbols starting with x-. With the results produce the following simple result list (organism will vary):

1323    x-file     Xenopus laevis
1324    x-men   Xenopus laevis
1325    x-ray     Xenopus laevis

Problem 5

Delete the gene x-ray using the geneId. Run the search and report in Problem 4 again to show the delete has taken place, with a result resembling the following:

1323    x-file     Xenopus laevis
1324    x-men   Xenopus laevis

Object-Relational Mapping Principles

Presentation by Sohel Merchant

Sohel Merchant, Bioinformatics Software Engineer at dictyBase, Center for Genetic Medicine, Northwestern University, Chicago. This is an edited version of Sohel's presentation.

Outline

The Problem
Solutions
ORM
Perl – Class::DBI
Summary

The Problem

Developers need to perform Create, Retrieve, Update, Delete (aka CRUD) operations on data inside an application.
The real world objects represented using a programming language needs to be stored in databases
Using relational databases to store object-oriented data leads to a semantic gap
RDBMS have fixed types, but OO can have more complicated user defined types.

Solutions

Data Access Object (DAO)
Developer writes a class which contains one attribute for each field in the table
Methods for CRUD typically contains JDBC/DBI code with the necessary SQL statements.
Object Relational Mapping (ORM), WikiPedia:
- “ORM is a programming technique that links databases to object-oriented language concepts, creating (in effect) a virtual object database.“
Developer needs to configure the ORM
Less amount of manual coding
CRUD methods are automatically generated by the ORM layer

ORM

ORM solutions

Perl
- Class::DBI
Java
- EJB
- Hibernate
- JDO
- iBatis

Perl - Class::DBI

Provides a simple interfaces for wrapping Perl classes around a database tables
Tables are mapped directly to objects
The table column name are mapped to the get/set methods
Can be used with transactions

Class::DBI

Defining a class in Class::DBI to represent a table:

  CVTERM
  cvterm_id
  cv_id
  name
  definition
  dbxref_id

Corresponding code:

<perl> package Chado::Cvterm; use base 'Chado::DBI'; Chado::Cvterm->set_up_table('Cvterm'); </perl>

Class::DBI - CRUD

<perl>

1. Create

$term_dbobj = Chado::Cvterm->create({

                              name      => ”DUMMY TERM”,
                              cv_id     => 1,
                              dbxref_id => 125
                       });

1. Retrieve

$term_dbobj = Chado::Cvterm->retrieve(2);

1. Update

$term_dbobj->name( $term->name() ); $term_dbobj->definition( $term->definition );

1. Delete

$term_dbobj->delete(); </perl>

Java - Hibernate

Hibernate maps Java Objects directly to database tables
Scalable
Works well for controlled Data model

Java - iBatis

iBATIS maps Java Objects to the results of SQL Queries
XML definitions for queries
Queries and managing Maps
Transactions
Good fit for existing database schema

Summary

ORM provides painless roundtrip of data between the application and database.
Reduces the amount of SQL code and allows a programmatic style interface to the RDBMS
Choice of ORM solution depends on the type of project

XORT

Background

Source: http://sourceforge.net/project/showfiles.php?group_id=27707
Language: Perl
Authors: Pinglei Zhou
Users:
Support:
Third party code:

Technical Overview

Database connectivity:
Transaction support:
Code generation:

Special topics

Additional demonstrations of what your software does well.

Limitations

Presentation by Pinglei Zhou and Josh Goodman

Generic Modern Language Database?

We speak many languages with different people, for example:

My Parents: hometown dialect
My wife: Mandarin (official form of Chinese)
My son: Plain English
My colleagues: ‘chadoXML’

ChadoXML is the common language in the FlyBase and Chado world.

Introduction

An XML-database mapping system for data exchange between DB and XML-driven application
Developed/Supported by Pinglei Zhou at FlyBase Harvard, 0.007 version now.
Used: All FlyBase sites
Written in Perl
Required perl modules:
- XML::Parser::PerlSAX
- Unicode::String
- XML::DOM
- DBI

Components

Database & Schema
ChadoXML Specification
DumpSpec collections
Tools

Highlights of Chado XML Specification

Unique represent of specific database schema
Get away with those internal primary key value
Static vs. Operational
Encoding for non-ASCII characters
Macro mechanism (object reference)

Putting it together: New FlyBase dataflow Part 1

1.a. Proforma (FlyBase Cambridge) is converted to ChadoXML

1.b. ChadoXML is created by Apollo (Harvard)

1.c. ChadoXML is created by Java SEAN (Harvard)

2. All ChadoXML is loaded into Chado by XORT

Putting it together: New FlyBase dataflow Part 2

3. Chado (Harvard) is denormalized and loaded into Chado (Indiana)

4. ChadoXML is created from Chado using XORT

5.a. GFF and Fasta is created from ChadoXML

5.b. HTML is created from Chado XML

Data & Report Generation

Content of all output files is controlled by XML dumpspecs.
- Dumpspecs are language independent.
- Easily readable (with knowledge of Chado structure).
All XML transformation steps are done with XSLT v2.
- Saxon XSLT (http://saxon.sourceforge.net/)
- ChadoXML is split into individual chunks before XSLT processing to accommodate large file sizes.
- Extremely fast. We can process all data for ~60,000 Drosophila genes in under 30 minutes.

Hibernate & XORT

Hibernate didn't scale well when dealing with 5,000+ features in bulk.
- The test was simply calling print() statements
Performance tweaks for Hibernate can be quite complicated to setup for bulk operations.
XORT is currently handling ~6 million features in production with only minor performance problems.
XORT is much more language independent.

Support for complex transactions using XORT

For example:

Find all records linked to a record using dumpspec
Merge gene x into y, each with thousands of records attached

Step 1. Dump all data use simple dumpspec

<chado>
 <feature dump=“all”>
  <uniquename test=“eq”>x</uniquename>
 </feature>
</chado>

Step 2 Delete feature x from DB, with triggers to clean orphan records, if necessary

Step 3. Edit the output xml, change uniquename x to y, then load the edited file back to DB

CHIA (Chado Interface Application)

A Java application that organizes SQL and XORT functionality for internal users, e.g.:

Dump chado-XML for gene regions for Apollo curation
Organize and execute “canned” SQL queries
Serve IDs for curators (in development)
Dynamic browser Chado without writing SQL statement

CHIA is being designed to be extensible for adding new functionality as needed.

Limitations

DB Schema follow certain rules
- All have internal int primary key
- All have unique key(s)
It may take long path to retrieve certain type of data
- Example: gene->allele->genotype->phenotype via feature_relationship
Structure not store in memory, you flush out data as it goes

Documentation

Using Chado to Store Genome Annotation Data
- Current Protocols in Bioinformatics (Baxevanis, A.D., and Davison, D.B., eds) 2, 9.6.1-9.6.28.
XORT specification docs
XORT draft (unpublished)
GMOD case demo procedure
- All in the doc directory of XORT package, http://www.gmod.org

Acknowledgements

Willian Gelbart
Chris Mungall
David Emmert
Mark Gibson
Stan Letovsky
Nomi Harris
Frank Smutniak
Suzanna Lewis
Peili Zhang
Stan Letovsky
Haiyan Zhang
Aubrey de Grey
Andy Schroeder
Don Gilbert
Susan Russo
Mark Zythovicz
Scott Cain
Lincoln Stein
Victor Strelets
Robert Wilson
Paul Leyland

Chado::AutoDBI

Background

Source: http://sourceforge.net/projects/gmod/
Language: Perl
Authors: Brian O'Connor
Users:
Support:
Third party code:

Technical Overview

Database connectivity:
Transaction support:
Code generation:

Special topics

Demonstrations of what your software does well

Limitations

Presentation by Brian O'Connor

Project Overview

Who wrote/supports it?
- Chado::AutoDBI: Allen Day, Scott Cain, Brian O'Connor, & others
- Turnkey: Allen Day, Scott Cain, Brian O'Connor
Third party code used?
- Based on Class::DBI: Michael Schwern & Tony Bowden

Technical Overview

Code Generation

Project Overview

Convert SQL Queries/Inserts/Deletes -> Object Calls

 INSERT INTO feature (organism_id, name)
                                 VALUES (1, 'foo');

To:

<perl>

   my $feature = Turnkey::Model::Feature->find_or_create({
                      organism_id => $organism,
   		       name => 'xfile', uniquename => 'xfile',
   		       type_id => $mrna_cvterm,
   		       is_analysis => 'f', is_obsolete => 'f'
   		       });

</perl>

Technical Overview

Database Connection: use a base class

<perl> use base qw(Class::DBI::Pg);

my ($dsn, $name, $pass); $dsn = "dbi:Pg:host=localhost;dbname=chado;port=5432"; $name = "postgres"; $pass = "";

Turnkey::Model::DBI->set_db('Main', $dsn, $name, $pass, {AutoCommit => 1}); </perl>

Technical Overview

Basic ORM Object: Feature

<perl> package Turnkey::Model::Feature; use base 'Turnkey::Model::DBI';

Turnkey::Model::Feature->set_up_table('feature');

Primary key accessors

sub id { shift->feature_id } sub feature { shift->feature_id } </perl>

data field accessors by Class::Accessor

Technical Overview

Basic ORM Object: Feature
- has_a

<perl>

has_a

Turnkey::Model::Feature->has_a( type_id => "Turnkey::Model::Cvterm" ); sub cvterm { return shift->type_id; } </perl>

Basic ORM Object: Feature
- has_many

<perl>

has_many

Turnkey::Model::Feature->has_many('feature_synonym_feature_id',

          'Turnkey::Model::Feature_Synonym' => 'feature_id');

sub feature_synonyms { return shift->feature_synonym_feature_id; }

Turnkey::Model::Feature->has_many('featureprop_feature_id',

          'Turnkey::Model::Featureprop' => 'feature_id');

sub featureprops { return shift->featureprop_feature_id; } </perl>

Technical Overview

Basic ORM Object: Feature
- skipping linker tables for has_many

<perl>

skip over feature_synonym table
method 1

sub synonyms { my $self = shift; return map $_->synonym_id, $self->feature_synonyms; }

method 2

Turnkey::Model::Feature->has_many( synonyms2 =>

                     ['Turnkey::Model::Feature_Synonym' => 'synonym_id']);

</perl>

Technical Overview

Transactions

<perl>

 sub do_transaction {
   my $class = shift;
   my ( $code ) = @_;
   # Turn off AutoCommit for this scope.
   # A commit will occur at the exit of this block automatically,
   # when the local AutoCommit goes out of scope.
   local $class->db_Main->{ AutoCommit };

   # Execute the required code inside the transaction.
   eval { $code->() };
   if ( $@ ) {
     my $commit_error = $@;
     eval { $class->dbi_rollback }; # might also die!
     die $commit_error;
   }
 }

</perl>

Technical Overview

Lazy Loading

<perl> Turnkey::Model::Feature->columns( Primary => qw/feature_id/ ); Turnkey::Model::Feature->columns( Essential => qw/name organism_id type_id/ ); Turnkey::Model::Feature->columns( Others => qw/residues .../ ); </perl>

Typically:

<perl> Turnkey::Model::Feature->set_up_table('feature'); </perl>

Problem 1

Create Feature & Add Description

<perl>

now create mRNA feature

my $feature = Turnkey::Model::Feature->find_or_create({

                      organism_id => $organism,
   		       name => 'xfile', uniquename => 'xfile',
   		       type_id => $mrna_cvterm,
   		       is_analysis => 'f', is_obsolete => 'f'
   		       });

create description

my $featureprop = Turnkey::Model::Featureprop->find_or_create({

                          value => 'A test gene for GMOD meeting',
                          feature_id => $feature,
   			   type_id => $note_cvterm,
   			   });

</perl>

Problem 2

Retrieve a Feature via Searching

<perl>

objects for global use

the organism for our new feature

my $organism = Turnkey::Model::Organism->search(abbreviation => "S.cerevisiae")->next;

the cvterm for a "Note"

my $note_cvterm = Turnkey::Model::Cvterm->retrieve(2);

searching name by wildcard

my @results = Turnkey::Model::Feature->search_like(name => 'x-%'); </perl>

Problems 3, 4, & 5

Update a Feature

<perl>

 # update the xfile gene name
 
 $feature->name("x-file");
 $feature->update();

</perl>

Delete a Feature

<perl>

now delete the x-file feature

$feature->delete(); </perl>

Special Topics

Things Chado::AutoDBI does well
- easy to use
- easy to port
  - other DBs
  - other platforms
- autogenerated via Turnkey
- find_or_create

Limitations

performance
joins & complex queries

<perl>

Add the add_constructor for looking for name lengths

__PACKAGE__ ->add_constructor(long_names => qq{ length(name) > 15 });

Custom SQL

__PACKAGE__->set_sql(xfiles => qq{

      SELECT FEATURE_ID
      FROM FEATURE
      WHERE NAME = 'xfiles' });

</perl>

For More Information

Class::DBI
- http://www.class-dbi.com
- http://search.cpan.org

Turnkey
- http://turnkey.sf.net

Biopackages
- http://biopackages.net

Modware

Background

Source: http://gmod-ware.sourceforge.net
Language: Perl
Authors: Sohel Merchant, Eric Just
Users:
Support:
Third party code:

Technical Overview

Database connectivity:
Transaction support:
Code generation:

Special topics

Demonstrations of what your software does well

Limitations

Presentation by Eric Just

Eric Just, Senior Bioinformatics Scientist, dictyBase: http://dictybase.org Center for Genetic Medicine, Northwestern University. This is an edited version of Eric's presentation.

Why Modware Was Developed

Each feature type requires different behavior
Want to leave schema semantics out of application
Want to leverage work done in BioPerl
Re-use code developed for common use cases

What is in the Feature Table?

The core of Chado

Chromosome
Contig
Gene
mRNA
Exon
Lots of other things - See Sequence Ontology!

Modware Features

Multiple Feature classes
- CHROMOSOME, GENE, MRNA, CONTIG
Each class provides type specific methods
Logic such as building exon structure of mRNA features is encapsulated
Parent class Modware::Feature
- Provides common methods
- Abstract factory for various feature types

Architectural Overview

Object-oriented Perl interface to Chado
Built on top of Chado::AutoDBI
Connection handled by GMOD
Database transactions supported
BioPerl used to represent and manipulate sequence and feature structure
‘Lazy’ evaluation

Create and Insert Chromosome

<perl>

  my $seq_io = new Bio::SeqIO(
     -file   => "../data/fake_chromosome.txt",
     -format => 'fasta'
  );

  # Bio::SeqIO will return a Bio::Seq object which
  # Modware uses as its representation
  my $seq = $seq_io->next_seq();

  my $reference_feature = new Modware::Feature(
     -type            => 'chromosome',
     -bioperl         => $seq,
     -description     => "This is a test",
     -name            => 'Fake',
     -source          => 'GMOD 2007 Demo'
  );

  # Inserts chromosome into database
  $reference_feature->insert();

</perl>

Create and Insert a Gene

1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.

                        Gene Feature
                            symbol: x-ray
                            synonyms: none
                            mRNA Feature
                                exon:
                                    start: 1703
                                    end: 1900
                                    strand: 1
                                    srcFeature_id: Id of genomic sample

Create and Insert a Gene

1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.

                        Gene Feature
                           symbol: x-men
                           synonyms: wolverine
                           mRNA Feature
                               exon_1: 
                                   start: 12648
                                   end: 13136
                                   strand: 1
                                   srcFeature_id: 
                                       Id of genomic sample

Create and Insert a Gene

1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.

                     Gene Feature
                         symbol: xfile
                         synonyms: mulder, scully
                         description: A test gene for GMOD meeting
                         mRNA Feature
                             exon_1: 
                                 start: 13691
                                 end: 13767
                                 strand: 1
                                 srcFeature_id: Id of genomic sample
                             exon_2: 
                                 start: 14687
                                 end: 14720
                                  strand: 1
                                  srcFeature_id: Id of genomic sample

Create and Insert a Gene

      symbol: xfile
             synonyms: mulder, scully
             description: A test gene for GMOD meeting
     …

<perl> my $gene_feature = new Modware::Feature(

   -type           => 'gene',
   -name           => 'xfile',
   -description    => 'A test gene for GMOD meeting',
   -source         => 'GMOD 2007 Demo‘

);

$gene_feature->add_synonym( 'mulder' ); $gene_feature->add_synonym( 'scully' );

inserts object into database

$gene_feature->insert(); print 'Inserted gene with feature_id:'.$gene_feature->feature_id()."\n"; </perl>

Create mRNA BioPerl Object

          exon_1:                                                    exon_2: 
              start: 13691                                             start: 14687
              end: 13767                                              end: 14720
              strand: 1                                                  strand: 1
              srcFeature_id: Id of genomic sample        srcFeature_id: Id of genomic sample

<perl>

First, create exon features (using Bioperl)

my $exon_1 = new Bio::SeqFeature::Gene::Exon (

  -start     => 13691,
  -end       => 13767,
  -strand    => 1,
  -is_coding => 1

);

my $exon_2 = new Bio::SeqFeature::Gene::Exon (

  -start     => 14687,
  -end       => 14720,
  -strand    => 1,
  -is_coding => 1

);

Next, create transcript feature to 'hold' exons (using Bioperl)

my $bioperl_mrna = new Bio::SeqFeature::Gene::Transcript();

Add exons to transcript (using Bioperl)

$bioperl_mrna->add_exon( $exon_1 ); $bioperl_mrna->add_exon( $exon_2 );

</perl>

Create and Insert mRNA

The BioPerl object holds the location information, but now we want to create a Modware object and link it to the gene as well as locate it on the chromosome.

<perl>

    # Now create Modware Feature to 'hold' bioperl object
    my $mrna_feature = new Modware::Feature(
        -type              => 'mRNA',
        -bioperl           => $bioperl_mrna,
        -source            => 'GMOD 2007 Demo',
        -reference_feature => $reference_feature
    );

    # Associate mRNA to gene (required for insertion)
    $mrna_feature->gene( $gene_feature );

   # inserts object into database
    $mrna_feature->insert();

</perl>

Writing the Report

2) Retrieve and print the following report for gene xfile

   symbol: xfile
   synonyms: mulder, scully
   description: A test gene for GMOD meeting
   type: gene
   exon1 start: 13691
   exon1 end: 13767
   exon2 start: 14687
   exon2 end: 14720
   >xfile cds
   ATGGCGTTAGTATTCATGGTTACTGGTTTCGCTACTGATATCACCCAGCGTGTAGGCTGT
   GGAATCGAACACTGGTATTGTATAAATGTTTGTGAATACACTGAGAAATAA

<perl>

       use Modware::Gene;
       use GMODWriter;

       my $xfile_gene = new Modware::Gene( -name => 'xfile' );
       GMODWriter->Write_gene_report( $xfile_gene );

</perl>

Writing the Report

2) Retrieve and print the following report for gene xfile

<perl> package GMODWriter; sub Write_gene_report { my ($self, $gene) = @_; my $symbol = $gene->name();

my @synonyms = @{ $gene->synonyms() }; my $syn_string = join ",", @synonyms; my $description = $gene->description(); my $type = $gene->type();

get features associated with the gene that are of type 'mRNA'

my ($mrna) = grep { $_->type() eq 'mRNA' } @{ $gene->features() };

use bioperl method to get exons from mRNA

my @exons = $mrna->bioperl->exons_ordered();

Modware will return a nice fasta file for you.

my $fasta = $mrna->sequence( -type => 'cds', -format => 'fasta' );

Now print the actual report

print "symbol: $symbol\n"; print "synonyms: $syn_string\n"; print "description: $description\n"; print "type: $type\n";

my $count = 0; foreach my $exon (@exons ) {

  $count++;
  print "exon${count} start: ".$exon->start()."\n";

  print "exon${count} end: ".$exon->end()."\n";

 }
 print "$fasta";

}

. . .

Updating a Gene Name

Problem 3) Update the gene xfile: change the name symbol to x-file and retrieve the changed record. Regenerate gene report

<perl>

use Modware::Gene;
use Modware::DBH;
use GMODWriter;

eval{

   # get xfile gene
   my $xfile_gene = new Modware::Gene( -name => 'xfile' );

   # change the name
   $xfile_gene->name( 'x-file' );
    # write changes to database
   $xfile_gene->update();

   # we can use the original object if we want, but instead
   # we refetch from the database to 'prove' the name has been changed
   my $xfile_gene2 = new Modware::Gene( -name => 'x-file' );
   # use our GMODWriter package to write report for x-file
   GMODWriter->Write_gene_report( $xfile_gene2 );

};
if ($@){
   warn $@;
   new Modware::DBH->rollback();
}

</perl>

Search and Display Results

Problem 4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list (organism will vary):

   1323    x-file  Xenopus laevis
   1324    x-men   Xenopus laevis
   1325    x-ray   Xenopus laevis

<perl>

    use Modware::Gene;
    use Modware::DBH;
    use GMODWriter;

    # find genes starting with 'x-'
    my $results = Modware::Search::Gene->Search_by_name( 'x-*' );

    # write the search results
    GMODWriter->Write_search_results( $results )

</perl>

Search and Display Results

Problem 4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list (organism will vary):

   1323    x-file  Xenopus laevis
   1324    x-men   Xenopus laevis
   1325    x-ray   Xenopus laevis

<perl> sub Write_search_results {

 my ($self, $itr) = @_;
 # loop through iterator
 while (my $gene = $itr->next) {
   # print the requested information
   print $gene->feature_id . "\t" . $gene->name .
     "\t" . $gene->organism_name . "\n";
 }

} </perl>

Delete a Gene

Problem 5) Delete the gene x-ray. Run the search and report again.

   1323    x-file  Xenopus laevis
   1324    x-men   Xenopus laevis

<perl>

# get the xray gene
my $xray = new Modware::Gene( -name => 'x-ray' );

# set is_deleted = 1, this will 'hide' the gene from Searches
$xray->is_deleted(1);

# write change to database
$xray->update();

# find genes starting with 'x-'
my $results = Modware::Search::Gene->Search_by_name( 'x-*' );

# write the search results
GMODWriter->Write_search_results( $results )

</perl>

Other Modware Highlights

Easy to write applications with Modware
Extensible
Available through Sourceforge

** http://gmod-ware.sourceforge.net

Easy to install
Large unit test coverage
Current release 0.2-RC1
- Works with GMOD’s latest release
Sample script demoed here are available
- sample_scripts directory

Other Nice Things About Modware

Bioperl-style documentation
- http://gmod-ware.sourceforge.net/doc/

Coming Attractions

Support for changing genomic sequence
ncRNAs
UTRs
Onotology modules
Phenotype Annotations
Send us your ideas!

Limitations

Does not have full flexibility of Chado
Not enough users to get quality feedback
Performance (?)
Language dependent

Acknowlegments

Rex Chisholm, PhD
Warren Kibbe, PhD
Scott Cain
Brian O’connor
Sohel Merchant
Petra Fey
Pascale Gaudet,
Karen Pilcher

BioPerl
GMOD
SGD

GBrowse (DasI) Adaptor

Background

Source: http://sourceforge.net/project/showfiles.php?group_id=27707&package_id=34513&release_id=433523
Language: Perl
Authors: Scott Cain
Users:
Support:
Third party code:

Technical Overview

Database connectivity:
Transaction support:
Code generation:

Special topics

Demonstrations of what your software does well

Limitations

Presentation by Scott Cain

iBatis

Background

Source: http://ibatis.apache.org/
Language: Java
Authors: Apache group
Users:
Support:
Third party code:

Technical Overview

Database connectivity:
Transaction support:
Code generation:

Special topics

Demonstrations of what your software does well

Limitations

Presentation by Jeff Bowes

Hibernate

Background

Source: http://www.hibernate.org
Language: Java
Authors: JBoss group
Users:
Support:
Third party code:

Technical Overview

Database connectivity:
Transaction support:
Code generation:

Special topics

Demonstrations of what your software does well

Limitations

Presentation by Robert Bruggner

PSU Chado Interface

Background

Source:
Language: Java
Authors: Chinmay Patel, Adrian Tivey
Users:
Support:
Third party code:

GMOD Middleware

Contents

Middleware for Chado databases

Ongoing Documentation

Middleware Evaluation January 2007

Introduction

General Evaluation Criteria

Problem 1

Problem 2

Problem 3

Problem 4

Problem 5

Object-Relational Mapping Principles

Presentation by Sohel Merchant

Outline

The Problem

Solutions

ORM

Perl - Class::DBI

Class::DBI

Class::DBI - CRUD

Java - Hibernate

Java - iBatis

Summary

XORT

Background

Technical Overview

Special topics

Limitations

Presentation by Pinglei Zhou and Josh Goodman

Generic Modern Language Database?

Introduction

Components

Highlights of Chado XML Specification

Putting it together: New FlyBase dataflow Part 1

Putting it together: New FlyBase dataflow Part 2

Data & Report Generation

Hibernate & XORT

Support for complex transactions using XORT

CHIA (Chado Interface Application)

Limitations

Documentation

Acknowledgements

Chado::AutoDBI

Background

Technical Overview

Special topics

Limitations

Presentation by Brian O'Connor

Project Overview

Technical Overview

Project Overview

Technical Overview

Technical Overview

Technical Overview

Technical Overview

Technical Overview

Technical Overview

Problem 1

Problem 2

Problems 3, 4, & 5

Special Topics

Limitations

For More Information

Modware

Background

Technical Overview

Special topics

Limitations

Presentation by Eric Just

Why Modware Was Developed

What is in the Feature Table?

Modware Features

Architectural Overview

Create and Insert Chromosome

Create and Insert a Gene

Create and Insert a Gene

Create and Insert a Gene

Create and Insert a Gene

Create mRNA BioPerl Object